Incidental Mutation 'R5314:Rbm11'
ID405767
Institutional Source Beutler Lab
Gene Symbol Rbm11
Ensembl Gene ENSMUSG00000032940
Gene NameRNA binding motif protein 11
Synonyms
MMRRC Submission 042897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5314 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location75592844-75602829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75596586 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 57 (F57L)
Ref Sequence ENSEMBL: ENSMUSP00000109891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046378] [ENSMUST00000114249] [ENSMUST00000114253]
Predicted Effect probably damaging
Transcript: ENSMUST00000046378
AA Change: F57L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038956
Gene: ENSMUSG00000032940
AA Change: F57L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114249
AA Change: F57L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109887
Gene: ENSMUSG00000032940
AA Change: F57L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114253
AA Change: F57L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109891
Gene: ENSMUSG00000032940
AA Change: F57L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik T C 3: 121,679,523 F109S unknown Het
Ankhd1 A T 18: 36,561,058 probably null Het
Atp8a1 C T 5: 67,705,905 probably null Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc136 G T 6: 29,417,498 V707F probably benign Het
Ccdc157 A T 11: 4,150,078 C91* probably null Het
Ceacam3 T A 7: 17,158,371 N346K possibly damaging Het
Chd4 A G 6: 125,100,588 E74G probably damaging Het
Cntn1 A G 15: 92,295,011 M665V probably benign Het
Crtc2 C T 3: 90,261,041 Q364* probably null Het
Csf1r T A 18: 61,129,724 I857N probably damaging Het
Dner C T 1: 84,580,739 G168D probably damaging Het
Edar T C 10: 58,607,360 T315A probably benign Het
Egflam A G 15: 7,304,012 V153A probably damaging Het
Enoph1 T C 5: 100,063,823 I193T possibly damaging Het
Epc1 A G 18: 6,462,969 I9T probably damaging Het
Fbxw18 T A 9: 109,693,178 I208F possibly damaging Het
Gm4841 A G 18: 60,270,292 V243A probably benign Het
Herc2 T C 7: 56,219,786 V4297A probably damaging Het
Itsn2 C T 12: 4,627,960 P106S probably benign Het
Kcnu1 A G 8: 25,862,458 T218A probably damaging Het
Kif1a A G 1: 93,018,498 S1677P probably damaging Het
Krt14 A T 11: 100,204,700 M293K probably damaging Het
Meis3 T A 7: 16,184,064 V307E probably damaging Het
Nadk2 A C 15: 9,108,313 I417L probably benign Het
Nav2 AAGCAGCAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCAGCAGCA 7: 49,408,692 probably benign Het
Neb A T 2: 52,281,503 N1659K probably benign Het
Olfr1490 T C 19: 13,655,266 V274A probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr951 T C 9: 39,394,489 S233P probably damaging Het
Pde3b A T 7: 114,494,537 N339Y probably damaging Het
Pde8b A G 13: 95,086,853 F298L possibly damaging Het
Phtf1 G A 3: 103,999,287 R606H probably damaging Het
Psd4 A G 2: 24,400,516 D535G possibly damaging Het
Rad51ap1 A G 6: 126,928,158 V130A probably damaging Het
Rprd2 A G 3: 95,764,089 V1334A possibly damaging Het
Satb2 T C 1: 56,831,527 E433G probably damaging Het
Sema6b G A 17: 56,128,413 R277* probably null Het
Sepsecs A T 5: 52,647,673 S349T probably benign Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Slc7a2 T C 8: 40,915,030 probably null Het
Smc1b T A 15: 85,070,865 Y1062F probably benign Het
Snrnp70 G A 7: 45,377,052 R298* probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Taar8c A T 10: 24,101,348 C189S probably damaging Het
Tas1r2 T A 4: 139,655,361 D103E probably damaging Het
Timd2 T C 11: 46,677,260 I236V probably benign Het
Tmem87a A G 2: 120,377,926 V316A probably damaging Het
Treml2 T A 17: 48,300,573 L16Q probably damaging Het
Wdr66 A G 5: 123,322,563 D1196G probably benign Het
Zcchc14 G A 8: 121,608,598 probably benign Het
Zfp462 T C 4: 55,013,178 Y567H probably damaging Het
Zfp551 G A 7: 12,416,160 R441* probably null Het
Zfp930 A G 8: 69,226,721 I59M probably benign Het
Other mutations in Rbm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Rbm11 APN 16 75600622 missense probably benign 0.01
IGL02245:Rbm11 APN 16 75593008 missense possibly damaging 0.74
IGL03350:Rbm11 APN 16 75600808 missense probably benign 0.31
R0060:Rbm11 UTSW 16 75598779 missense probably damaging 0.98
R0815:Rbm11 UTSW 16 75596637 missense probably damaging 1.00
R1351:Rbm11 UTSW 16 75596643 missense possibly damaging 0.91
R1562:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R1793:Rbm11 UTSW 16 75600797 missense probably damaging 1.00
R1891:Rbm11 UTSW 16 75600787 missense possibly damaging 0.87
R1965:Rbm11 UTSW 16 75598768 splice site probably null
R3757:Rbm11 UTSW 16 75596581 missense probably damaging 1.00
R3928:Rbm11 UTSW 16 75593044 critical splice donor site probably null
R4513:Rbm11 UTSW 16 75596587 missense probably damaging 1.00
R5418:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R5530:Rbm11 UTSW 16 75592973 missense possibly damaging 0.66
R5891:Rbm11 UTSW 16 75598837 missense possibly damaging 0.55
R6293:Rbm11 UTSW 16 75596767 splice site probably null
R7853:Rbm11 UTSW 16 75593035 missense probably damaging 1.00
R8167:Rbm11 UTSW 16 75598785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTGGAGCTATTAACGACTGTTC -3'
(R):5'- TATAGCAATCTGTGGGTGGTAAAC -3'

Sequencing Primer
(F):5'- TCAAGTTTCTTACAGGCTG -3'
(R):5'- GAGAGGTTGAGAACTACTATCCTCC -3'
Posted On2016-07-22