Mutagenetix > Incidental Mutations

Incidental Mutation 'R5315:Epha4'

405778

Institutional Source

Beutler Lab

Gene Symbol

Epha4

Ensembl Gene

ENSMUSG00000026235

Gene Name

Eph receptor A4

Synonyms

rb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1

MMRRC Submission

042898-MU

Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R5315 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77367185-77515088 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 77388472 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]

Predicted Effect

probably null
Transcript: ENSMUST00000027451

SMART Domains

Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	548	618	1.7e-24	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000188797

SMART Domains

Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000188797

SMART Domains

Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188952

SMART Domains

Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190149

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.1%
20x: 97.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130204L05Rik	G	A	3: 91,090,330	T26M	possibly damaging	Het
Ace3	T	C	11: 105,994,921	V51A	probably benign	Het
Ass1	A	T	2: 31,492,329	I171F	probably benign	Het
AU041133	T	G	10: 82,151,672	Y386*	probably null	Het
Bex6	A	G	16: 32,186,493	N40D	probably benign	Het
Cc2d2a	A	G	5: 43,720,433	Y1044C	probably damaging	Het
Cflar	C	G	1: 58,753,802	D442E	probably benign	Het
Dag1	A	G	9: 108,209,117	V275A	probably damaging	Het
Dnah17	G	A	11: 118,127,283	R129W	possibly damaging	Het
Eri2	T	C	7: 119,786,018	D420G	probably benign	Het
Gm42669	A	T	5: 107,508,237	I1301F	probably damaging	Het
Golga2	A	G	2: 32,303,761	E463G	probably damaging	Het
Grsf1	G	A	5: 88,673,775		probably benign	Het
Igkv6-15	A	C	6: 70,406,973	V7G	possibly damaging	Het
Katnal2	A	T	18: 77,012,009	V143D	probably benign	Het
Mepce	A	C	5: 137,782,693	I617S	probably damaging	Het
Mms19	C	T	19: 41,954,762	R320Q	possibly damaging	Het
Nt5c2	T	C	19: 46,892,243	Y353C	probably damaging	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Olfr502	A	G	7: 108,523,890	L20S	probably damaging	Het
Pitpnm2	A	T	5: 124,121,933	D1111E	probably benign	Het
Plin5	C	A	17: 56,114,066	V200L	probably benign	Het
Rab3a	T	C	8: 70,755,922	F23L	probably damaging	Het
Rrp8	T	C	7: 105,734,000	K353R	probably benign	Het
Senp7	A	G	16: 56,180,526	D887G	probably benign	Het
Sftpb	G	T	6: 72,306,892	A158S	probably benign	Het
Sh2d2a	A	C	3: 87,847,669	T23P	probably damaging	Het
Siglecf	T	C	7: 43,355,108	L287P	probably benign	Het
Slc4a1	T	A	11: 102,358,254	I233F	possibly damaging	Het
Spef2	T	C	15: 9,596,691	Q1424R	probably damaging	Het
Tbc1d14	T	C	5: 36,507,588	D567G	probably damaging	Het
Tmem106b	T	G	6: 13,081,560	N155K	probably damaging	Het
Vmn2r2	C	A	3: 64,116,956	V735F	probably benign	Het
Zfp850	T	C	7: 27,990,318	K155R	probably benign	Het

Other mutations in Epha4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01315:Epha4	APN	1	77398557	missense	probably benign	0.00
IGL01350:Epha4	APN	1	77506855	missense	probably damaging	1.00
IGL01657:Epha4	APN	1	77426838	missense	probably damaging	1.00
IGL01872:Epha4	APN	1	77383039	missense	probably benign	0.03
IGL02366:Epha4	APN	1	77426711	nonsense	probably null
IGL02426:Epha4	APN	1	77444877	missense	probably benign	0.01
IGL02428:Epha4	APN	1	77506748	missense	possibly damaging	0.94
IGL02706:Epha4	APN	1	77426845	missense	probably damaging	1.00
IGL02716:Epha4	APN	1	77380965	missense	probably damaging	1.00
IGL03348:Epha4	APN	1	77507172	missense	possibly damaging	0.82
frog	UTSW	1	77481076	intron	probably benign
R0324:Epha4	UTSW	1	77383551	missense	probably damaging	1.00
R0392:Epha4	UTSW	1	77506973	missense	probably benign	0.00
R0538:Epha4	UTSW	1	77388541	missense	probably damaging	1.00
R0562:Epha4	UTSW	1	77388487	missense	probably benign	0.00
R0885:Epha4	UTSW	1	77382939	missense	probably damaging	0.99
R1509:Epha4	UTSW	1	77380886	missense	probably damaging	1.00
R1620:Epha4	UTSW	1	77374926	missense	probably benign	0.31
R1624:Epha4	UTSW	1	77399692	missense	probably damaging	1.00
R1654:Epha4	UTSW	1	77374768	splice site	probably null
R1755:Epha4	UTSW	1	77387823	missense	probably damaging	1.00
R1807:Epha4	UTSW	1	77374904	missense	probably benign	0.05
R2046:Epha4	UTSW	1	77507162	missense	probably damaging	1.00
R2504:Epha4	UTSW	1	77382991	missense	probably damaging	1.00
R2509:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R2511:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R3441:Epha4	UTSW	1	77426696	missense	possibly damaging	0.90
R3724:Epha4	UTSW	1	77426543	splice site	probably benign
R3901:Epha4	UTSW	1	77380902	missense	probably damaging	1.00
R3950:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3951:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3952:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R4012:Epha4	UTSW	1	77390094	splice site	probably benign
R4321:Epha4	UTSW	1	77507213	critical splice acceptor site	probably null
R4422:Epha4	UTSW	1	77511717	missense	probably damaging	0.99
R4898:Epha4	UTSW	1	77390075	nonsense	probably null
R5072:Epha4	UTSW	1	77445002	missense	probably damaging	1.00
R5270:Epha4	UTSW	1	77506607	missense	probably damaging	1.00
R5281:Epha4	UTSW	1	77374867	missense	probably benign
R5531:Epha4	UTSW	1	77374876	missense	probably benign
R5621:Epha4	UTSW	1	77515049	utr 5 prime	probably benign
R5648:Epha4	UTSW	1	77398525	missense	probably benign	0.25
R5747:Epha4	UTSW	1	77506883	missense	probably damaging	0.99
R5829:Epha4	UTSW	1	77444994	missense	probably benign	0.01
R6185:Epha4	UTSW	1	77507106	missense	probably damaging	1.00
R6486:Epha4	UTSW	1	77383549	missense	probably damaging	1.00
R6821:Epha4	UTSW	1	77382945	missense	possibly damaging	0.88
R6978:Epha4	UTSW	1	77377583	missense	probably damaging	1.00
R7039:Epha4	UTSW	1	77506785	missense	probably damaging	1.00
R7216:Epha4	UTSW	1	77444984	missense	probably damaging	1.00
R7270:Epha4	UTSW	1	77399785	missense	probably damaging	1.00
R7444:Epha4	UTSW	1	77387916	missense	probably damaging	1.00
R7737:Epha4	UTSW	1	77381012	missense	probably damaging	1.00
R7763:Epha4	UTSW	1	77390031	critical splice donor site	probably null
Z1088:Epha4	UTSW	1	77506662	missense	possibly damaging	0.61
Z1176:Epha4	UTSW	1	77373733	makesense	probably null
Z1176:Epha4	UTSW	1	77383011	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAAAGTTCCTTACAGAACATTGC -3'
(R):5'- GGCCATAGAGTTAACCCAGC -3'

Sequencing Primer
(F):5'- CGTACGTGCAATACACTC -3'
(R):5'- GGCCATAGAGTTAACCCAGCTTTTG -3'

Posted On

2016-07-22