Incidental Mutation 'R5315:Sh2d2a'
ID405783
Institutional Source Beutler Lab
Gene Symbol Sh2d2a
Ensembl Gene ENSMUSG00000028071
Gene NameSH2 domain containing 2A
SynonymsLad, Lck-associated adapter protein, RIBP, TSAd, Rlk/Itk-binding protein
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87846755-87855722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87847669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 23 (T23P)
Ref Sequence ENSEMBL: ENSMUSP00000103207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029709] [ENSMUST00000107581]
Predicted Effect probably damaging
Transcript: ENSMUST00000029709
AA Change: T23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029709
Gene: ENSMUSG00000028071
AA Change: T23P

DomainStartEndE-ValueType
SH2 114 197 2.31e-23 SMART
low complexity region 235 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107581
AA Change: T23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103207
Gene: ENSMUSG00000028071
AA Change: T23P

DomainStartEndE-ValueType
SH2 114 197 2.31e-23 SMART
low complexity region 235 249 N/A INTRINSIC
Blast:SH2 281 316 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194639
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein thought to function in T-cell signal transduction. A related protein in mouse is responsible for the activation of lymphocyte-specific protein-tyrosine kinase and functions in downstream signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: While T cell development is normal, T cell proliferation in response to TCR-mediated activation is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Sh2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Sh2d2a APN 3 87851829 missense probably benign 0.00
IGL01563:Sh2d2a APN 3 87852125 missense probably damaging 1.00
R0178:Sh2d2a UTSW 3 87849423 missense probably benign 0.24
R0522:Sh2d2a UTSW 3 87847109 critical splice donor site probably null
R0545:Sh2d2a UTSW 3 87851888 splice site probably benign
R1977:Sh2d2a UTSW 3 87851816 nonsense probably null
R3076:Sh2d2a UTSW 3 87852170 missense probably benign
R3684:Sh2d2a UTSW 3 87851720 splice site probably null
R4981:Sh2d2a UTSW 3 87849421 missense probably damaging 1.00
R5082:Sh2d2a UTSW 3 87851784 missense probably benign 0.12
R5789:Sh2d2a UTSW 3 87849513 intron probably benign
R7189:Sh2d2a UTSW 3 87848361 missense possibly damaging 0.50
X0062:Sh2d2a UTSW 3 87847763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCTGGTACACACTTGCAC -3'
(R):5'- CCCAGCTTGCATTTTGACATGG -3'

Sequencing Primer
(F):5'- GGTACACACTTGCACTTCTCCTG -3'
(R):5'- ATGGGTTCATGTGCACACC -3'
Posted On2016-07-22