Incidental Mutation 'R5315:Tbc1d14'
ID405785
Institutional Source Beutler Lab
Gene Symbol Tbc1d14
Ensembl Gene ENSMUSG00000029192
Gene NameTBC1 domain family, member 14
Synonyms2810413P16Rik, D5Ertd110e
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36490604-36593276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36507588 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 567 (D567G)
Ref Sequence ENSEMBL: ENSMUSP00000116519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031094] [ENSMUST00000124036] [ENSMUST00000126077] [ENSMUST00000130417] [ENSMUST00000136189] [ENSMUST00000140607] [ENSMUST00000146430] [ENSMUST00000150813] [ENSMUST00000171385]
Predicted Effect probably benign
Transcript: ENSMUST00000031094
AA Change: D547G

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031094
Gene: ENSMUSG00000029192
AA Change: D547G

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124036
AA Change: D567G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117414
Gene: ENSMUSG00000029192
AA Change: D567G

DomainStartEndE-ValueType
low complexity region 179 194 N/A INTRINSIC
Blast:TBC 336 395 1e-8 BLAST
TBC 419 655 1.49e-54 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126077
AA Change: D266G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114508
Gene: ENSMUSG00000029192
AA Change: D266G

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130417
AA Change: D567G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116519
Gene: ENSMUSG00000029192
AA Change: D567G

DomainStartEndE-ValueType
low complexity region 179 194 N/A INTRINSIC
Blast:TBC 336 395 1e-8 BLAST
TBC 419 655 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136189
SMART Domains Protein: ENSMUSP00000115467
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 247 322 1e-32 BLAST
TBC 399 559 8.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140607
AA Change: D547G

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121516
Gene: ENSMUSG00000029192
AA Change: D547G

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146430
AA Change: D547G

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121816
Gene: ENSMUSG00000029192
AA Change: D547G

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149157
Predicted Effect possibly damaging
Transcript: ENSMUST00000150813
AA Change: D266G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115926
Gene: ENSMUSG00000029192
AA Change: D266G

DomainStartEndE-ValueType
Blast:TBC 35 94 3e-9 BLAST
TBC 118 305 1.08e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171385
AA Change: D266G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131876
Gene: ENSMUSG00000029192
AA Change: D266G

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173532
SMART Domains Protein: ENSMUSP00000133477
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RabGAP-TBC 59 129 6.8e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173757
AA Change: D25G
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for an ENU-induced mutation appear arrested at an egg cylinder-like state and show complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Tbc1d14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Tbc1d14 APN 5 36543200 nonsense probably null
IGL01759:Tbc1d14 APN 5 36571569 missense probably damaging 1.00
IGL01939:Tbc1d14 APN 5 36508437 unclassified probably benign
IGL01977:Tbc1d14 APN 5 36505037 missense probably damaging 1.00
IGL02064:Tbc1d14 APN 5 36507675 nonsense probably null
IGL02250:Tbc1d14 APN 5 36571519 missense probably damaging 1.00
IGL02370:Tbc1d14 APN 5 36495218 missense possibly damaging 0.68
IGL03088:Tbc1d14 APN 5 36524964 missense probably damaging 1.00
R0408:Tbc1d14 UTSW 5 36571299 missense possibly damaging 0.83
R1863:Tbc1d14 UTSW 5 36507693 missense probably damaging 1.00
R2007:Tbc1d14 UTSW 5 36571374 missense possibly damaging 0.78
R2064:Tbc1d14 UTSW 5 36522930 nonsense probably null
R2266:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2267:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2268:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2269:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R3955:Tbc1d14 UTSW 5 36543215 nonsense probably null
R4222:Tbc1d14 UTSW 5 36493108 missense probably benign
R4618:Tbc1d14 UTSW 5 36530381 intron probably benign
R4780:Tbc1d14 UTSW 5 36571256 intron probably benign
R4817:Tbc1d14 UTSW 5 36571831 missense probably damaging 1.00
R5521:Tbc1d14 UTSW 5 36520552 missense probably damaging 0.99
R5590:Tbc1d14 UTSW 5 36525045 missense probably damaging 1.00
R6190:Tbc1d14 UTSW 5 36571884 missense possibly damaging 0.58
R6502:Tbc1d14 UTSW 5 36520481 missense possibly damaging 0.62
R6748:Tbc1d14 UTSW 5 36495254 missense probably damaging 0.96
R7089:Tbc1d14 UTSW 5 36512540 missense probably benign 0.03
R7667:Tbc1d14 UTSW 5 36495038 missense probably damaging 1.00
R8020:Tbc1d14 UTSW 5 36571843 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTTGCACAGAAGTCACCGTC -3'
(R):5'- AAAGCTGCTTTGACCTTTTGGC -3'

Sequencing Primer
(F):5'- CTCCAGGAGAATGCATTAATCTGTGC -3'
(R):5'- GACCTTTTGGCCACATTAGTTAAC -3'
Posted On2016-07-22