Incidental Mutation 'R5315:Olfr502'
ID405799
Institutional Source Beutler Lab
Gene Symbol Olfr502
Ensembl Gene ENSMUSG00000058014
Gene Nameolfactory receptor 502
SynonymsGA_x6K02T2PBJ9-10853935-10852991, MOR204-8
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108520825-108525065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108523890 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 20 (L20S)
Ref Sequence ENSEMBL: ENSMUSP00000151167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078933] [ENSMUST00000216919]
Predicted Effect probably damaging
Transcript: ENSMUST00000078933
AA Change: L20S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077963
Gene: ENSMUSG00000058014
AA Change: L20S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.8e-55 PFAM
Pfam:7tm_1 44 293 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208361
Predicted Effect probably damaging
Transcript: ENSMUST00000216919
AA Change: L20S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Olfr502
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr502 APN 7 108523285 missense probably benign 0.00
R0007:Olfr502 UTSW 7 108523213 missense probably damaging 1.00
R0650:Olfr502 UTSW 7 108523082 missense probably damaging 1.00
R1448:Olfr502 UTSW 7 108523318 missense probably benign
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R1469:Olfr502 UTSW 7 108523204 missense probably benign 0.14
R1701:Olfr502 UTSW 7 108523524 missense probably benign 0.01
R3736:Olfr502 UTSW 7 108523419 missense possibly damaging 0.79
R5030:Olfr502 UTSW 7 108523177 missense possibly damaging 0.66
R6052:Olfr502 UTSW 7 108523738 missense probably benign 0.34
R6548:Olfr502 UTSW 7 108523216 missense probably benign 0.00
R6866:Olfr502 UTSW 7 108523170 missense probably damaging 0.96
R6946:Olfr502 UTSW 7 108523321 missense probably benign 0.02
R7582:Olfr502 UTSW 7 108523851 missense probably benign 0.00
Z1088:Olfr502 UTSW 7 108523398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAAGCATATTGGGTGTGAC -3'
(R):5'- GCAGGCAAATAAGTTTGGATGC -3'

Sequencing Primer
(F):5'- CAGAAGATGAATAGCCTATGTCAGC -3'
(R):5'- AGGCAAATAAGTTTGGATGCTTGGTC -3'
Posted On2016-07-22