Incidental Mutation 'R5315:Slc4a1'
ID405805
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Namesolute carrier family 4 (anion exchanger), member 1
SynonymsAe1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
MMRRC Submission 042898-MU
Accession Numbers

Genbank: NM_011403; MGI: 109393

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102348824-102366203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102358254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 233 (I233F)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006749
AA Change: I233F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: I233F

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102357964 missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102353903 missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102354333 missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102356267 missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102359146 critical splice acceptor site probably null
Rumor UTSW 11 102361222 nonsense probably null
A5278:Slc4a1 UTSW 11 102353815 splice site probably benign
R0011:Slc4a1 UTSW 11 102357110 missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102352684 missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102354366 missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102357915 splice site probably benign
R0635:Slc4a1 UTSW 11 102352672 missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102361171 missense probably benign
R1816:Slc4a1 UTSW 11 102351230 missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102350307 missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102356830 missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102359302 missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102357193 missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102356258 missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102351503 missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102353261 missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102361383 missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102359077 missense probably damaging 0.98
R5478:Slc4a1 UTSW 11 102350314 missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102353266 missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102356525 missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102352531 missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102356735 missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102361222 nonsense probably null
R6717:Slc4a1 UTSW 11 102354423 missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102356258 missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102353867 missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102356484 missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102361419 start gained probably benign
R7582:Slc4a1 UTSW 11 102352577 missense probably damaging 0.99
RF006:Slc4a1 UTSW 11 102356716 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGAAAATTAGCCCGGCC -3'
(R):5'- TGAGGACCTAGGGAATCTGG -3'

Sequencing Primer
(F):5'- AAAATTAGCCCGGCCTGTGG -3'
(R):5'- AGCCATCGCTGGAGACC -3'
Posted On2016-07-22