Incidental Mutation 'R5315:Nt5c2'
ID405816
Institutional Source Beutler Lab
Gene Symbol Nt5c2
Ensembl Gene ENSMUSG00000025041
Gene Name5'-nucleotidase, cytosolic II
SynonymsPNT5, NT5B, cN-II
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46886831-47015153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46892243 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 353 (Y353C)
Ref Sequence ENSEMBL: ENSMUSP00000130898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086961] [ENSMUST00000168536] [ENSMUST00000172239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086961
AA Change: Y352C

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084180
Gene: ENSMUSG00000025041
AA Change: Y352C

DomainStartEndE-ValueType
Pfam:5_nucleotid 60 518 3.5e-185 PFAM
low complexity region 574 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168536
AA Change: Y327C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129126
Gene: ENSMUSG00000025041
AA Change: Y327C

DomainStartEndE-ValueType
Pfam:5_nucleotid 35 493 1.6e-185 PFAM
low complexity region 549 560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172239
AA Change: Y353C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130898
Gene: ENSMUSG00000025041
AA Change: Y353C

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
Pfam:5_nucleotid 61 515 6.5e-179 PFAM
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174731
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
PHENOTYPE: Bone marrow cells with a nucleotide substitution allele used in a transplantation experiment following tamoxifen-induction produce NOTCH1-induced tumors that are resistant to 6-mercaptopurine chemotherapy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Nt5c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nt5c2 APN 19 46896515 missense possibly damaging 0.91
IGL00814:Nt5c2 APN 19 46897648 missense probably benign 0.02
IGL02347:Nt5c2 APN 19 46924256 splice site probably benign
IGL02630:Nt5c2 APN 19 46924310 missense probably benign 0.00
tightrope UTSW 19 46924327 missense probably damaging 1.00
R0565:Nt5c2 UTSW 19 46897625 missense probably damaging 0.99
R0825:Nt5c2 UTSW 19 46898905 unclassified probably benign
R0980:Nt5c2 UTSW 19 46898878 missense probably benign
R1496:Nt5c2 UTSW 19 46904978 missense probably damaging 1.00
R2394:Nt5c2 UTSW 19 46890067 critical splice donor site probably null
R3854:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3855:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3856:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R4534:Nt5c2 UTSW 19 46891661 missense probably damaging 1.00
R4907:Nt5c2 UTSW 19 46896539 missense possibly damaging 0.71
R5122:Nt5c2 UTSW 19 46889921 missense probably damaging 1.00
R5203:Nt5c2 UTSW 19 46889808 missense probably damaging 1.00
R5226:Nt5c2 UTSW 19 46898629 missense probably damaging 1.00
R5254:Nt5c2 UTSW 19 46893560 nonsense probably null
R6401:Nt5c2 UTSW 19 46889811 missense probably benign 0.11
R6784:Nt5c2 UTSW 19 46924327 missense probably damaging 1.00
R7040:Nt5c2 UTSW 19 46893535 missense possibly damaging 0.52
R7414:Nt5c2 UTSW 19 46889889 missense probably damaging 1.00
R7792:Nt5c2 UTSW 19 46889946 missense probably benign 0.02
R7793:Nt5c2 UTSW 19 46891581 missense probably benign 0.23
X0028:Nt5c2 UTSW 19 46891615 missense probably damaging 1.00
X0065:Nt5c2 UTSW 19 46890088 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGTTTCAGAACTGAGACAAACC -3'
(R):5'- GGGAGTGTGATCTGATCTGACC -3'

Sequencing Primer
(F):5'- TCAACAGAGGACAGAAGGATCTTTTC -3'
(R):5'- TGATCTGATCTGACCTAGCCCAATAG -3'
Posted On2016-07-22