Incidental Mutation 'R5316:Klhl7'
ID405821
Institutional Source Beutler Lab
Gene Symbol Klhl7
Ensembl Gene ENSMUSG00000028986
Gene Namekelch-like 7
Synonyms2700038B03Rik, SBBI26, D5Ertd363e, Klhl6
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24100605-24160792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24127750 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 102 (A102V)
Ref Sequence ENSEMBL: ENSMUSP00000143000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030841] [ENSMUST00000163409] [ENSMUST00000200116]
Predicted Effect probably benign
Transcript: ENSMUST00000030841
AA Change: A102V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030841
Gene: ENSMUSG00000028986
AA Change: A102V

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 481 2.25e-11 SMART
Kelch 482 528 4.4e-5 SMART
Blast:Kelch 529 576 1e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163409
AA Change: A102V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129461
Gene: ENSMUSG00000028986
AA Change: A102V

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 7.49e-29 SMART
BACK 146 248 8.42e-36 SMART
Kelch 337 382 7.5e0 SMART
Kelch 383 430 1.97e-7 SMART
Kelch 431 470 4.1e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199530
Predicted Effect probably benign
Transcript: ENSMUST00000200116
AA Change: A102V

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143000
Gene: ENSMUSG00000028986
AA Change: A102V

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
BTB 44 141 4.7e-31 SMART
BACK 146 248 6.3e-40 SMART
Pfam:Kelch_1 325 365 2.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Klhl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Klhl7 APN 5 24141281 nonsense probably null
IGL03149:Klhl7 APN 5 24159689 missense probably benign 0.02
R0433:Klhl7 UTSW 5 24127702 missense probably damaging 0.98
R1301:Klhl7 UTSW 5 24159491 missense probably damaging 1.00
R1521:Klhl7 UTSW 5 24149110 splice site probably null
R2143:Klhl7 UTSW 5 24100863 missense probably benign
R2144:Klhl7 UTSW 5 24100863 missense probably benign
R2145:Klhl7 UTSW 5 24100863 missense probably benign
R3409:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R3410:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R3411:Klhl7 UTSW 5 24138321 missense probably damaging 0.96
R4927:Klhl7 UTSW 5 24141187 missense possibly damaging 0.81
R5284:Klhl7 UTSW 5 24159617 missense probably benign 0.01
R5400:Klhl7 UTSW 5 24126920 missense probably damaging 1.00
R6644:Klhl7 UTSW 5 24149246 missense probably damaging 1.00
R7122:Klhl7 UTSW 5 24138435 missense probably damaging 0.99
R7567:Klhl7 UTSW 5 24126846 missense probably benign
R7658:Klhl7 UTSW 5 24141286 missense probably benign 0.11
R8312:Klhl7 UTSW 5 24134967 missense probably damaging 1.00
X0067:Klhl7 UTSW 5 24141295 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCTCAATTCAACAGGTGCTAC -3'
(R):5'- ACTGTGAAGTGTACTCTCCTATG -3'

Sequencing Primer
(F):5'- ATAACAGTCCTAGTGGTCACTGTG -3'
(R):5'- GAAGTGTACTCTCCTATGACATTAGG -3'
Posted On2016-07-22