Mutagenetix > Incidental Mutation

Incidental Mutation 'R5316:Cog2'

405830

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

042899-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5316 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124529040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 122 (D122G)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460
AA Change: D122G

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: D122G

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

probably benign
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176279

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410015M20Rik	G	A	17: 56,609,649	S7L	possibly damaging	Het
Adam6b	G	A	12: 113,491,393	R610H	probably damaging	Het
Agap2	G	A	10: 127,082,427		probably null	Het
Apol10a	A	G	15: 77,488,529	T122A	probably damaging	Het
Arhgap17	G	T	7: 123,296,527	A458D	possibly damaging	Het
Cd80	C	T	16: 38,473,877	Q41*	probably null	Het
Cmss1	T	G	16: 57,302,275	K252T	probably damaging	Het
Dsc3	T	A	18: 19,963,541	D841V	possibly damaging	Het
Dst	C	A	1: 34,223,848	Q4549K	probably damaging	Het
Efcab3	A	G	11: 105,076,460	I5275M	possibly damaging	Het
Epha6	A	G	16: 59,954,720	L711P	probably damaging	Het
Fam208a	A	G	14: 27,472,035	D1064G	possibly damaging	Het
Gabrg2	T	A	11: 41,976,558	N78I	probably damaging	Het
Hist1h1a	C	T	13: 23,764,102		probably benign	Het
Htra3	T	C	5: 35,664,076	D319G	probably damaging	Het
Jph1	T	C	1: 17,091,526	Y304C	probably damaging	Het
Kat2a	G	T	11: 100,712,170	Q79K	possibly damaging	Het
Klhl7	C	T	5: 24,127,750	A102V	probably benign	Het
Lamb3	A	G	1: 193,330,193	H426R	probably benign	Het
Lemd3	C	A	10: 120,952,256		probably null	Het
Mcm3ap	A	C	10: 76,470,926	D291A	possibly damaging	Het
Mme	C	G	3: 63,368,954	F717L	probably damaging	Het
Mybpc2	T	A	7: 44,520,382	K171*	probably null	Het
Naip6	T	C	13: 100,283,782	N1327D	probably benign	Het
Nr2e1	A	T	10: 42,571,491	M175K	probably benign	Het
Olfr160	A	T	9: 37,711,685	V198D	possibly damaging	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Ppef2	A	T	5: 92,235,811	M480K	probably benign	Het
Prkar2b	A	T	12: 32,060,985	L33Q	probably damaging	Het
Ralgps2	A	T	1: 156,813,497	V496E	probably damaging	Het
Rbms2	G	A	10: 128,145,737	P81L	probably damaging	Het
Scara5	T	C	14: 65,689,815	S54P	possibly damaging	Het
Slc18a3	T	C	14: 32,462,857	D523G	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Srrt	C	A	5: 137,296,551	A747S	probably benign	Het
Sycp2	C	T	2: 178,356,503	D1075N	probably benign	Het
Vat1l	G	A	8: 114,284,348	V279I	probably damaging	Het
Zfp677	A	G	17: 21,397,148	K156E	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GGTGCCTTACAGGGATTCATTC -3'
(R):5'- GTAGCACGTAACAGACTGCC -3'

Sequencing Primer
(F):5'- ACAGGGATTCATTCATCTCATGC -3'
(R):5'- TAGCACGTAACAGACTGCCTTAAAAC -3'

Posted On

2016-07-22