Incidental Mutation 'R5316:Cog2'
ID405830
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124529040 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
AA Change: D122G

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: D122G

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect probably benign
Transcript: ENSMUST00000176159
SMART Domains Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176279
SMART Domains Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 101 1.5e-37 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTGCCTTACAGGGATTCATTC -3'
(R):5'- GTAGCACGTAACAGACTGCC -3'

Sequencing Primer
(F):5'- ACAGGGATTCATTCATCTCATGC -3'
(R):5'- TAGCACGTAACAGACTGCCTTAAAAC -3'
Posted On2016-07-22