Incidental Mutation 'R5316:Scara5'
ID405848
Institutional Source Beutler Lab
Gene Symbol Scara5
Ensembl Gene ENSMUSG00000022032
Gene Namescavenger receptor class A, member 5
Synonyms4932433F15Rik, 4933425F03Rik
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65666403-65764826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65689815 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000063391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022610] [ENSMUST00000069226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022610
AA Change: S54P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022610
Gene: ENSMUSG00000022032
AA Change: S54P

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 357 1.8e-8 PFAM
Pfam:Collagen 327 383 1.1e-8 PFAM
SR 389 489 5.5e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069226
AA Change: S54P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063391
Gene: ENSMUSG00000022032
AA Change: S54P

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 360 1e-11 PFAM
Pfam:Collagen 329 386 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154373
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in decreased male fertility and lymphocytic infiltration of the stroma of various tissues, particularly in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Scara5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Scara5 APN 14 65738415 splice site probably benign
IGL00772:Scara5 APN 14 65670562 utr 5 prime probably benign
IGL01768:Scara5 APN 14 65689775 nonsense probably null
IGL02081:Scara5 APN 14 65730655 missense possibly damaging 0.96
IGL02280:Scara5 APN 14 65730778 missense probably benign
IGL02795:Scara5 APN 14 65730680 missense possibly damaging 0.72
IGL02887:Scara5 APN 14 65762829 missense unknown
R0040:Scara5 UTSW 14 65762717 splice site probably benign
R0605:Scara5 UTSW 14 65759648 missense possibly damaging 0.85
R0735:Scara5 UTSW 14 65731019 missense possibly damaging 0.85
R0925:Scara5 UTSW 14 65762718 critical splice acceptor site probably benign
R1575:Scara5 UTSW 14 65730865 missense probably benign 0.18
R1746:Scara5 UTSW 14 65731090 missense probably benign
R1968:Scara5 UTSW 14 65689800 missense possibly damaging 0.73
R4455:Scara5 UTSW 14 65762747 missense probably benign 0.01
R4547:Scara5 UTSW 14 65670574 missense possibly damaging 0.72
R4779:Scara5 UTSW 14 65730749 missense probably benign 0.03
R5218:Scara5 UTSW 14 65759662 frame shift probably null
R5331:Scara5 UTSW 14 65759662 frame shift probably null
R5332:Scara5 UTSW 14 65759662 frame shift probably null
R5366:Scara5 UTSW 14 65759662 frame shift probably null
R5367:Scara5 UTSW 14 65759662 frame shift probably null
R5368:Scara5 UTSW 14 65759662 frame shift probably null
R5369:Scara5 UTSW 14 65759662 frame shift probably null
R5417:Scara5 UTSW 14 65759662 frame shift probably null
R5418:Scara5 UTSW 14 65759662 frame shift probably null
R5420:Scara5 UTSW 14 65759662 frame shift probably null
R5447:Scara5 UTSW 14 65759662 frame shift probably null
R5473:Scara5 UTSW 14 65740339 missense possibly damaging 0.84
R5580:Scara5 UTSW 14 65731079 missense probably benign 0.02
R7734:Scara5 UTSW 14 65731151 missense possibly damaging 0.85
R7995:Scara5 UTSW 14 65759608 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAACAGCATGTGATGGCCC -3'
(R):5'- GGTTTCCATAGCAACAAGGAC -3'

Sequencing Primer
(F):5'- CATGTGATGGCCCTAGAAAGTTCC -3'
(R):5'- AGACTGCTCTTACCTGCT -3'
Posted On2016-07-22