Incidental Mutation 'R5316:Olfr284'
ID405851
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98340365 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 208 (A208V)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: A192V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: A192V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: A208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5272:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5317:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5717:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5921:Olfr284 UTSW 15 98340429 missense probably benign 0.10
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7392:Olfr284 UTSW 15 98340311 missense probably benign 0.03
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
R7633:Olfr284 UTSW 15 98340086 missense probably damaging 1.00
R7724:Olfr284 UTSW 15 98340894 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCGGTAAGAGATAACTGATAAACCC -3'
(R):5'- TTGCTCTACAGCCAGGTGATG -3'

Sequencing Primer
(F):5'- GAGATAACTGATAAACCCCGAGC -3'
(R):5'- CTCTACAGCCAGGTGATGAGTAGC -3'
Posted On2016-07-22