Incidental Mutation 'R5316:Cmss1'
ID405853
Institutional Source Beutler Lab
Gene Symbol Cmss1
Ensembl Gene ENSMUSG00000022748
Gene Namecms small ribosomal subunit 1
Synonyms4930572F24Rik, 1110001A06Rik, 2610528E23Rik
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57302000-57606864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57302275 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 252 (K252T)
Ref Sequence ENSEMBL: ENSMUSP00000110011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371]
Predicted Effect probably damaging
Transcript: ENSMUST00000114371
AA Change: K252T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748
AA Change: K252T

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Cmss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cmss1 APN 16 57303729 missense probably damaging 0.99
R0031:Cmss1 UTSW 16 57311249 splice site probably null
R1231:Cmss1 UTSW 16 57316197 missense probably benign 0.14
R1556:Cmss1 UTSW 16 57316197 missense probably benign 0.14
R2017:Cmss1 UTSW 16 57316278 missense probably damaging 0.99
R3748:Cmss1 UTSW 16 57302272 missense probably damaging 0.96
R4835:Cmss1 UTSW 16 57316182 nonsense probably null
R5598:Cmss1 UTSW 16 57311286 missense probably damaging 1.00
R5987:Cmss1 UTSW 16 57302245 missense probably benign 0.40
R7145:Cmss1 UTSW 16 57311355 missense probably benign 0.19
R7664:Cmss1 UTSW 16 57317947 missense probably benign 0.00
R8377:Cmss1 UTSW 16 57307394 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACAGTTGTCAAAGAATCCCCTC -3'
(R):5'- ACTCATGTTTTGCGCAGTACC -3'

Sequencing Primer
(F):5'- TTGTCAAAGAATCCCCTCGAGGC -3'
(R):5'- ATGTTTTGCGCAGTACCTCTCTC -3'
Posted On2016-07-22