Incidental Mutation 'R5316:Epha6'
ID 405854
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5316 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59954720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 711 (L711P)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860] [ENSMUST00000161358]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: L711P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: L711P

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161358
SMART Domains Protein: ENSMUSP00000124340
Gene: ENSMUSG00000055540

DomainStartEndE-ValueType
Pfam:EphA2_TM 9 88 1.2e-26 PFAM
Pfam:Pkinase_Tyr 91 183 3e-18 PFAM
Pfam:Pkinase 91 296 1.5e-29 PFAM
Pfam:Pkinase_Tyr 179 295 6e-31 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Jph1 T C 1: 17,091,526 Y304C probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGCACCCTAGTTTCTTTG -3'
(R):5'- GTGCAGGCATCAACCTAGAG -3'

Sequencing Primer
(F):5'- TTATGAAAACAGGCTATGGAATGTG -3'
(R):5'- GGCATCAACCTAGAGGGACAAC -3'
Posted On 2016-07-22