Incidental Mutation 'R0498:Trpc4'
ID40586
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Nametransient receptor potential cation channel, subfamily C, member 4
SynonymsTrrp4, STRPC4, Trp4, CCE1
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54156035-54318471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54291211 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 519 (F519L)
Ref Sequence ENSEMBL: ENSMUSP00000143593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
Predicted Effect probably damaging
Transcript: ENSMUST00000029311
AA Change: F519L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: F519L

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200048
AA Change: F519L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: F519L

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 0.97
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1623:Trpc4 UTSW 3 54299179 missense probably damaging 1.00
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54315842 missense probably damaging 1.00
R6276:Trpc4 UTSW 3 54318020 missense probably benign 0.25
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
R7082:Trpc4 UTSW 3 54299098 nonsense probably null
R7215:Trpc4 UTSW 3 54194896 missense possibly damaging 0.83
R7299:Trpc4 UTSW 3 54317627 missense possibly damaging 0.87
R7423:Trpc4 UTSW 3 54318029 missense probably benign
R7459:Trpc4 UTSW 3 54291232 missense probably damaging 0.97
R7538:Trpc4 UTSW 3 54318095 missense possibly damaging 0.92
R7542:Trpc4 UTSW 3 54315654 missense probably damaging 1.00
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGCCATCTTAAAGCATACAC -3'
(R):5'- GCCTCTCCGACTTACGTGGAAAAC -3'

Sequencing Primer
(F):5'- GCATACACCTTCCAGAGAGTGG -3'
(R):5'- CGCGTTGTTCTGTTTCTCG -3'
Posted On2013-05-23