Incidental Mutation 'R5317:Vsig10l'
ID405869
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene NameV-set and immunoglobulin domain containing 10 like
Synonyms
MMRRC Submission 042900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5317 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43463151-43472019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43464823 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 190 (S190P)
Ref Sequence ENSEMBL: ENSMUSP00000144692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107977
AA Change: S292P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: S292P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203152
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203769
AA Change: S190P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: S190P

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205247
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih1 A C 9: 59,393,336 H542Q probably benign Het
Cnot8 T C 11: 58,113,203 S155P probably damaging Het
Dcc C T 18: 71,384,155 E810K possibly damaging Het
Dmrt2 T C 19: 25,673,480 V10A probably benign Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Eif4a3 G T 11: 119,294,664 H117N probably damaging Het
Fam160b1 T A 19: 57,381,709 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm884 T C 11: 103,614,145 I2332M possibly damaging Het
Gpr179 T A 11: 97,337,845 Q1161H probably damaging Het
Grm1 T G 10: 10,746,699 M427L possibly damaging Het
Grxcr2 T A 18: 41,998,851 H51L probably damaging Het
Il1rn C T 2: 24,349,542 T150I probably benign Het
Kcnc4 C T 3: 107,458,739 R51H probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Mcm9 G A 10: 53,538,234 P250L probably damaging Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pan3 T C 5: 147,543,210 probably null Het
Pcdhgb7 T A 18: 37,752,834 D352E probably benign Het
Pdgfa A G 5: 138,988,347 probably null Het
Pkhd1 T C 1: 20,450,304 D1938G probably damaging Het
Plac8 C T 5: 100,556,479 probably null Het
Rab11fip3 T C 17: 26,068,078 E367G possibly damaging Het
Sgo2a C T 1: 58,015,524 P289L probably benign Het
Slc22a18 T C 7: 143,499,159 Y374H probably damaging Het
Slco2a1 T C 9: 103,079,579 V530A probably benign Het
Spty2d1 A T 7: 46,998,301 S293R possibly damaging Het
Stt3b G T 9: 115,252,510 Y569* probably null Het
Tas2r140 A G 6: 133,055,580 Y72H probably benign Het
Usp35 C T 7: 97,311,639 R860H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,583 M79K probably benign Het
Wisp1 T G 15: 66,917,282 S206A probably benign Het
Wwc2 C T 8: 47,847,555 D958N unknown Het
Zfp318 AAGAAGG A 17: 46,412,537 probably benign Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43465254 missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43466465 missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43464044 missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43463747 missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43463914 missense probably benign 0.02
IGL02636:Vsig10l APN 7 43463578 missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43465242 missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43466464 missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43464869 missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43468101 missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43465455 missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43467442 missense probably damaging 1.00
R0632:Vsig10l UTSW 7 43464137 missense probably damaging 0.97
R1689:Vsig10l UTSW 7 43465368 missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43468761 missense probably benign 0.00
R3015:Vsig10l UTSW 7 43467457 missense possibly damaging 0.73
R4024:Vsig10l UTSW 7 43468086 missense probably benign 0.33
R4031:Vsig10l UTSW 7 43465374 missense probably damaging 1.00
R4807:Vsig10l UTSW 7 43463749 missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43465317 nonsense probably null
R5261:Vsig10l UTSW 7 43470850 missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43464823 missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43464151 nonsense probably null
R5842:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6012:Vsig10l UTSW 7 43468015 missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6309:Vsig10l UTSW 7 43470973 utr 3 prime probably null
R6994:Vsig10l UTSW 7 43465067 missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43463675 missense probably benign
R7397:Vsig10l UTSW 7 43468007 missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43463717 missense probably damaging 0.96
R8086:Vsig10l UTSW 7 43465452 missense possibly damaging 0.92
R8139:Vsig10l UTSW 7 43463729 missense probably benign 0.00
R8297:Vsig10l UTSW 7 43464107 missense possibly damaging 0.50
X0028:Vsig10l UTSW 7 43463364 utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43467490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCTATATCCCTGGATCAGAG -3'
(R):5'- TTCGGACCTGGCAAGTGTAC -3'

Sequencing Primer
(F):5'- CTATATCCCTGGATCAGAGGAAGAAG -3'
(R):5'- TGAGATGAGCAGCTGGTCC -3'
Posted On2016-07-22