Incidental Mutation 'R5317:Slco2a1'
ID405878
Institutional Source Beutler Lab
Gene Symbol Slco2a1
Ensembl Gene ENSMUSG00000032548
Gene Namesolute carrier organic anion transporter family, member 2a1
SynonymsPgt, mPgt, 2310021C19Rik, Slc21a2
MMRRC Submission 042900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5317 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102988712-103096002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103079579 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 530 (V530A)
Ref Sequence ENSEMBL: ENSMUSP00000035148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]
Predicted Effect probably benign
Transcript: ENSMUST00000035148
AA Change: V530A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: V530A

DomainStartEndE-ValueType
Pfam:MFS_1 39 428 3.5e-22 PFAM
KAZAL 446 493 2.78e-2 SMART
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188664
SMART Domains Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548

DomainStartEndE-ValueType
Pfam:OATP 31 381 4.8e-135 PFAM
Pfam:MFS_1 39 413 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216778
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih1 A C 9: 59,393,336 H542Q probably benign Het
Cnot8 T C 11: 58,113,203 S155P probably damaging Het
Dcc C T 18: 71,384,155 E810K possibly damaging Het
Dmrt2 T C 19: 25,673,480 V10A probably benign Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Eif4a3 G T 11: 119,294,664 H117N probably damaging Het
Fam160b1 T A 19: 57,381,709 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm884 T C 11: 103,614,145 I2332M possibly damaging Het
Gpr179 T A 11: 97,337,845 Q1161H probably damaging Het
Grm1 T G 10: 10,746,699 M427L possibly damaging Het
Grxcr2 T A 18: 41,998,851 H51L probably damaging Het
Il1rn C T 2: 24,349,542 T150I probably benign Het
Kcnc4 C T 3: 107,458,739 R51H probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Mcm9 G A 10: 53,538,234 P250L probably damaging Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pan3 T C 5: 147,543,210 probably null Het
Pcdhgb7 T A 18: 37,752,834 D352E probably benign Het
Pdgfa A G 5: 138,988,347 probably null Het
Pkhd1 T C 1: 20,450,304 D1938G probably damaging Het
Plac8 C T 5: 100,556,479 probably null Het
Rab11fip3 T C 17: 26,068,078 E367G possibly damaging Het
Sgo2a C T 1: 58,015,524 P289L probably benign Het
Slc22a18 T C 7: 143,499,159 Y374H probably damaging Het
Spty2d1 A T 7: 46,998,301 S293R possibly damaging Het
Stt3b G T 9: 115,252,510 Y569* probably null Het
Tas2r140 A G 6: 133,055,580 Y72H probably benign Het
Usp35 C T 7: 97,311,639 R860H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,583 M79K probably benign Het
Vsig10l T C 7: 43,464,823 S190P probably damaging Het
Wisp1 T G 15: 66,917,282 S206A probably benign Het
Wwc2 C T 8: 47,847,555 D958N unknown Het
Zfp318 AAGAAGG A 17: 46,412,537 probably benign Het
Other mutations in Slco2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slco2a1 APN 9 103079441 splice site probably benign
IGL01481:Slco2a1 APN 9 103070251 missense probably damaging 1.00
IGL01647:Slco2a1 APN 9 103070296 missense possibly damaging 0.57
IGL01885:Slco2a1 APN 9 103074430 missense probably damaging 1.00
IGL02150:Slco2a1 APN 9 103084818 missense probably damaging 1.00
IGL02508:Slco2a1 APN 9 103074416 missense probably benign
IGL02578:Slco2a1 APN 9 103046758 missense probably damaging 1.00
IGL02622:Slco2a1 APN 9 103076929 nonsense probably null
IGL02898:Slco2a1 APN 9 103079606 missense probably damaging 1.00
IGL03101:Slco2a1 APN 9 103077006 missense possibly damaging 0.69
PIT4431001:Slco2a1 UTSW 9 103050268 missense probably damaging 1.00
R0410:Slco2a1 UTSW 9 103073314 critical splice donor site probably null
R0831:Slco2a1 UTSW 9 103082334 missense probably damaging 0.99
R0885:Slco2a1 UTSW 9 103082383 missense probably damaging 0.98
R1975:Slco2a1 UTSW 9 103079454 nonsense probably null
R2095:Slco2a1 UTSW 9 103076968 missense probably benign 0.22
R4072:Slco2a1 UTSW 9 103068002 missense probably damaging 1.00
R4105:Slco2a1 UTSW 9 103067876 missense probably benign 0.01
R4105:Slco2a1 UTSW 9 103073250 missense probably damaging 1.00
R4804:Slco2a1 UTSW 9 103073184 missense probably damaging 1.00
R4881:Slco2a1 UTSW 9 103085832 missense possibly damaging 0.71
R5073:Slco2a1 UTSW 9 103046726 missense probably damaging 1.00
R5124:Slco2a1 UTSW 9 103050166 missense probably damaging 1.00
R5147:Slco2a1 UTSW 9 103050269 missense probably damaging 1.00
R5363:Slco2a1 UTSW 9 103070263 missense probably damaging 0.99
R5381:Slco2a1 UTSW 9 103068014 missense probably damaging 1.00
R5732:Slco2a1 UTSW 9 103050256 missense probably damaging 1.00
R5736:Slco2a1 UTSW 9 103067830 missense probably benign 0.00
R5924:Slco2a1 UTSW 9 103046699 nonsense probably null
R5945:Slco2a1 UTSW 9 103046790 missense probably damaging 1.00
R6293:Slco2a1 UTSW 9 103050147 missense probably benign 0.30
R6386:Slco2a1 UTSW 9 103076988 missense probably benign
R6622:Slco2a1 UTSW 9 103074505 missense possibly damaging 0.84
R7325:Slco2a1 UTSW 9 103085749 splice site probably null
R7484:Slco2a1 UTSW 9 103067986 missense probably damaging 1.00
Z1088:Slco2a1 UTSW 9 103079527 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCATATTAGAGGGAGGCAGTG -3'
(R):5'- GAACTCCTGCCATCAGTGTAC -3'

Sequencing Primer
(F):5'- GCAGTGTGGATATGTGAAACATAC -3'
(R):5'- AACTCCTGCCATCAGTGTACCTATTG -3'
Posted On2016-07-22