Incidental Mutation 'R5317:Olfr284'
ID405888
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 042900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5317 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98340365 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 208 (A208V)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: A192V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: A192V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: A208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih1 A C 9: 59,393,336 H542Q probably benign Het
Cnot8 T C 11: 58,113,203 S155P probably damaging Het
Dcc C T 18: 71,384,155 E810K possibly damaging Het
Dmrt2 T C 19: 25,673,480 V10A probably benign Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Eif4a3 G T 11: 119,294,664 H117N probably damaging Het
Fam160b1 T A 19: 57,381,709 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm884 T C 11: 103,614,145 I2332M possibly damaging Het
Gpr179 T A 11: 97,337,845 Q1161H probably damaging Het
Grm1 T G 10: 10,746,699 M427L possibly damaging Het
Grxcr2 T A 18: 41,998,851 H51L probably damaging Het
Il1rn C T 2: 24,349,542 T150I probably benign Het
Kcnc4 C T 3: 107,458,739 R51H probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Mcm9 G A 10: 53,538,234 P250L probably damaging Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Pan3 T C 5: 147,543,210 probably null Het
Pcdhgb7 T A 18: 37,752,834 D352E probably benign Het
Pdgfa A G 5: 138,988,347 probably null Het
Pkhd1 T C 1: 20,450,304 D1938G probably damaging Het
Plac8 C T 5: 100,556,479 probably null Het
Rab11fip3 T C 17: 26,068,078 E367G possibly damaging Het
Sgo2a C T 1: 58,015,524 P289L probably benign Het
Slc22a18 T C 7: 143,499,159 Y374H probably damaging Het
Slco2a1 T C 9: 103,079,579 V530A probably benign Het
Spty2d1 A T 7: 46,998,301 S293R possibly damaging Het
Stt3b G T 9: 115,252,510 Y569* probably null Het
Tas2r140 A G 6: 133,055,580 Y72H probably benign Het
Usp35 C T 7: 97,311,639 R860H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,583 M79K probably benign Het
Vsig10l T C 7: 43,464,823 S190P probably damaging Het
Wisp1 T G 15: 66,917,282 S206A probably benign Het
Wwc2 C T 8: 47,847,555 D958N unknown Het
Zfp318 AAGAAGG A 17: 46,412,537 probably benign Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5272:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5316:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5717:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5921:Olfr284 UTSW 15 98340429 missense probably benign 0.10
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7392:Olfr284 UTSW 15 98340311 missense probably benign 0.03
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
R7633:Olfr284 UTSW 15 98340086 missense probably damaging 1.00
R7724:Olfr284 UTSW 15 98340894 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTGAAGCCGGTAAGAGATAAC -3'
(R):5'- CTACAGCCAGGTGATGAGTAGC -3'

Sequencing Primer
(F):5'- CGGTAAGAGATAACTGATAAACCCCG -3'
(R):5'- CAGGTGATGAGTAGCCAGCTCTG -3'
Posted On2016-07-22