Incidental Mutation 'R5317:Gm7102'
ID405898
Institutional Source Beutler Lab
Gene Symbol Gm7102
Ensembl Gene ENSMUSG00000094649
Gene Namepredicted gene 7102
Synonyms
MMRRC Submission 042900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5317 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location61174686-61176309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61175926 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000137574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180168]
Predicted Effect unknown
Transcript: ENSMUST00000180168
AA Change: G24R
SMART Domains Protein: ENSMUSP00000137574
Gene: ENSMUSG00000094649
AA Change: G24R

DomainStartEndE-ValueType
Pfam:MPLKIP 31 170 8.9e-27 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih1 A C 9: 59,393,336 H542Q probably benign Het
Cnot8 T C 11: 58,113,203 S155P probably damaging Het
Dcc C T 18: 71,384,155 E810K possibly damaging Het
Dmrt2 T C 19: 25,673,480 V10A probably benign Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Eif4a3 G T 11: 119,294,664 H117N probably damaging Het
Fam160b1 T A 19: 57,381,709 probably null Het
Gm884 T C 11: 103,614,145 I2332M possibly damaging Het
Gpr179 T A 11: 97,337,845 Q1161H probably damaging Het
Grm1 T G 10: 10,746,699 M427L possibly damaging Het
Grxcr2 T A 18: 41,998,851 H51L probably damaging Het
Il1rn C T 2: 24,349,542 T150I probably benign Het
Kcnc4 C T 3: 107,458,739 R51H probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Mcm9 G A 10: 53,538,234 P250L probably damaging Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pan3 T C 5: 147,543,210 probably null Het
Pcdhgb7 T A 18: 37,752,834 D352E probably benign Het
Pdgfa A G 5: 138,988,347 probably null Het
Pkhd1 T C 1: 20,450,304 D1938G probably damaging Het
Plac8 C T 5: 100,556,479 probably null Het
Rab11fip3 T C 17: 26,068,078 E367G possibly damaging Het
Sgo2a C T 1: 58,015,524 P289L probably benign Het
Slc22a18 T C 7: 143,499,159 Y374H probably damaging Het
Slco2a1 T C 9: 103,079,579 V530A probably benign Het
Spty2d1 A T 7: 46,998,301 S293R possibly damaging Het
Stt3b G T 9: 115,252,510 Y569* probably null Het
Tas2r140 A G 6: 133,055,580 Y72H probably benign Het
Usp35 C T 7: 97,311,639 R860H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,583 M79K probably benign Het
Vsig10l T C 7: 43,464,823 S190P probably damaging Het
Wisp1 T G 15: 66,917,282 S206A probably benign Het
Wwc2 C T 8: 47,847,555 D958N unknown Het
Zfp318 AAGAAGG A 17: 46,412,537 probably benign Het
Other mutations in Gm7102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Gm7102 APN 19 61175761 missense probably damaging 0.98
IGL02958:Gm7102 APN 19 61175680 missense possibly damaging 0.83
R0427:Gm7102 UTSW 19 61175470 missense probably damaging 1.00
R1886:Gm7102 UTSW 19 61175698 missense probably damaging 0.97
R4576:Gm7102 UTSW 19 61175926 missense unknown
R4578:Gm7102 UTSW 19 61175926 missense unknown
R4615:Gm7102 UTSW 19 61175926 missense unknown
R4616:Gm7102 UTSW 19 61175926 missense unknown
R4617:Gm7102 UTSW 19 61175926 missense unknown
R4621:Gm7102 UTSW 19 61175926 missense unknown
R4622:Gm7102 UTSW 19 61175926 missense unknown
R4623:Gm7102 UTSW 19 61175926 missense unknown
R4826:Gm7102 UTSW 19 61175926 missense unknown
R4827:Gm7102 UTSW 19 61175926 missense unknown
R4829:Gm7102 UTSW 19 61175926 missense unknown
R4830:Gm7102 UTSW 19 61175926 missense unknown
R4870:Gm7102 UTSW 19 61175926 missense unknown
R4871:Gm7102 UTSW 19 61175926 missense unknown
R4951:Gm7102 UTSW 19 61175926 missense unknown
R5112:Gm7102 UTSW 19 61175926 missense unknown
R5301:Gm7102 UTSW 19 61175926 missense unknown
R5335:Gm7102 UTSW 19 61175926 missense unknown
R5397:Gm7102 UTSW 19 61175926 missense unknown
R5399:Gm7102 UTSW 19 61175926 missense unknown
R5591:Gm7102 UTSW 19 61175926 missense unknown
R5592:Gm7102 UTSW 19 61175926 missense unknown
R5594:Gm7102 UTSW 19 61175926 missense unknown
R5616:Gm7102 UTSW 19 61175926 missense unknown
R5884:Gm7102 UTSW 19 61175926 missense unknown
R5919:Gm7102 UTSW 19 61175469 missense probably damaging 1.00
R7003:Gm7102 UTSW 19 61175881 missense possibly damaging 0.93
R7112:Gm7102 UTSW 19 61175559 missense probably damaging 1.00
R7266:Gm7102 UTSW 19 61175535 missense possibly damaging 0.84
Z1177:Gm7102 UTSW 19 61175750 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCCGAACTGATGCTG -3'
(R):5'- TCTGGCAGTTGATCGCTGAG -3'

Sequencing Primer
(F):5'- AACTGATGCTGGGACCCC -3'
(R):5'- GATCGCTGAGGTTCGGC -3'
Posted On2016-07-22