Incidental Mutation 'R0498:Map3k7'
ID40590
Institutional Source Beutler Lab
Gene Symbol Map3k7
Ensembl Gene ENSMUSG00000028284
Gene Namemitogen-activated protein kinase kinase kinase 7
SynonymsTGF-beta activated kinase 1, Tak1, transforming growth factor beta-activated kinase 1, transforming growth factor-beta-activated kinase 1, TAK1
MMRRC Submission 038694-MU
Accession Numbers

Ncbi RefSeq: NM_009316.1, NM_172688.3; MGI:1346877

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0498 (G1)
Quality Score156
Status Validated
Chromosome4
Chromosomal Location31964097-32023467 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31974814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037607] [ENSMUST00000080933] [ENSMUST00000108183] [ENSMUST00000108184]
Predicted Effect probably benign
Transcript: ENSMUST00000037607
SMART Domains Protein: ENSMUSP00000040307
Gene: ENSMUSG00000028284

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.2e-61 PFAM
Pfam:Pkinase 36 285 2.8e-56 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 528 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080933
SMART Domains Protein: ENSMUSP00000079734
Gene: ENSMUSG00000028284

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.7e-61 PFAM
Pfam:Pkinase 36 285 8.4e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
coiled coil region 501 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108183
SMART Domains Protein: ENSMUSP00000103818
Gene: ENSMUSG00000028284

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
S_TKc 36 284 1.6e-63 SMART
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108184
SMART Domains Protein: ENSMUSP00000103819
Gene: ENSMUSG00000028284

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 5.6e-62 PFAM
Pfam:Pkinase 36 285 2.8e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143138
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype Strain: 3664194; 3608889; 3696053
Lethality: E9-E11
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis and may have impaired vascular remodeling, edema, or an open, wavy neural tube. Mice with conditional deletion in immune cells show impaired cell development and activation. [provided by MGI curators]
Allele List at MGI

All alleles(62) : Targeted(7) Gene trapped(55)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Map3k7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Map3k7 APN 4 32019539 missense probably damaging 1.00
IGL01677:Map3k7 APN 4 32017158 intron probably benign
IGL02608:Map3k7 APN 4 31981452 splice site probably benign
IGL02796:Map3k7 UTSW 4 31979692 intron probably benign
R0377:Map3k7 UTSW 4 31985731 missense probably damaging 1.00
R1547:Map3k7 UTSW 4 31991796 missense probably benign 0.31
R2360:Map3k7 UTSW 4 31964302 missense unknown
R4709:Map3k7 UTSW 4 31985700 nonsense probably null
R4815:Map3k7 UTSW 4 31988592 missense probably damaging 0.98
R5497:Map3k7 UTSW 4 31991719 missense possibly damaging 0.56
R5813:Map3k7 UTSW 4 31964318 missense probably damaging 1.00
R6349:Map3k7 UTSW 4 31988661 missense possibly damaging 0.87
R7314:Map3k7 UTSW 4 31985769 nonsense probably null
X0066:Map3k7 UTSW 4 31974848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTAACACATTTTGCGTGTCCTTC -3'
(R):5'- TCAACTGCTAACGTCCATGTACACAG -3'

Sequencing Primer
(F):5'- CCCCCAATTAGAGTTATTTGAAAGC -3'
(R):5'- TAACGTCCATGTACACAGAAAAAAG -3'
Posted On2013-05-23