Incidental Mutation 'R5318:Grik3'
ID 405909
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 042901-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R5318 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125694136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 683 (E683G)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: E683G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: E683G

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,567,986 E74K possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankfn1 A G 11: 89,391,928 S298P probably damaging Het
Arfgef2 A C 2: 166,873,971 K1393N probably damaging Het
Atp4a T A 7: 30,715,329 V181E probably damaging Het
Bin3 A G 14: 70,134,512 D134G possibly damaging Het
Cabs1 A G 5: 87,980,566 T359A possibly damaging Het
Cblb A T 16: 52,186,198 K754N possibly damaging Het
Ccdc153 A T 9: 44,245,765 R135* probably null Het
Cel T C 2: 28,557,708 E398G possibly damaging Het
Clip1 G A 5: 123,613,084 probably benign Het
Dnase2b C A 3: 146,582,455 R295L probably benign Het
Dnm3 G A 1: 162,011,807 Q194* probably null Het
Dtx2 T A 5: 136,012,100 S120T possibly damaging Het
Fat3 A T 9: 16,376,629 S533T probably damaging Het
Foxred2 T C 15: 77,952,398 I306V probably benign Het
Gdpd5 A T 7: 99,453,027 T278S probably benign Het
Gli2 T A 1: 118,844,470 T502S probably damaging Het
Gm10436 A T 12: 88,176,228 C207S probably benign Het
Gm21830 A T 2: 67,432,814 probably null Het
Gm38394 A G 1: 133,658,115 S495P possibly damaging Het
Gm5617 T A 9: 48,495,911 I115N possibly damaging Het
Gpr75 G T 11: 30,892,459 A455S probably benign Het
Grin2b T C 6: 135,733,918 I877V probably damaging Het
Gsg1l2 G T 11: 67,782,521 C109F possibly damaging Het
H2-Q4 G A 17: 35,383,311 V341I possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kif5c A G 2: 49,671,828 K68R probably benign Het
Lct T A 1: 128,304,372 H580L probably damaging Het
Lrrtm4 A G 6: 80,022,512 I302M probably damaging Het
Mef2b A T 8: 70,166,843 R228W probably damaging Het
Mtus2 T A 5: 148,076,572 D58E probably benign Het
Myh15 T G 16: 49,110,471 S603A probably damaging Het
Olfr26 C T 9: 38,855,448 P129S probably damaging Het
Olfr283 A G 15: 98,378,642 I156T possibly damaging Het
Olfr54 T C 11: 51,027,593 V197A probably benign Het
P2rx4 G A 5: 122,719,148 C149Y probably null Het
Proca1 T A 11: 78,201,857 V43E possibly damaging Het
Rftn1 G T 17: 49,994,458 N454K probably benign Het
Rrp15 T C 1: 186,721,546 T235A probably benign Het
Serpina6 T C 12: 103,653,962 E176G possibly damaging Het
Shprh T G 10: 11,166,557 I761M probably benign Het
Smg1 A T 7: 118,160,204 probably benign Het
Snupn T C 9: 56,957,061 S15P probably damaging Het
Tbc1d15 A T 10: 115,208,969 Y509* probably null Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tdrd3 T C 14: 87,477,463 probably null Het
Tm9sf4 T A 2: 153,187,656 V175D probably benign Het
Vmn1r201 T C 13: 22,474,922 L102P probably damaging Het
Wdfy4 T A 14: 33,078,343 N1788I possibly damaging Het
Xpc A C 6: 91,493,010 V744G probably damaging Het
Xrcc6 T C 15: 82,037,507 F178L probably damaging Het
Zfyve26 A G 12: 79,270,850 V1196A probably benign Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
R9030:Grik3 UTSW 4 125632392 missense probably benign 0.24
R9243:Grik3 UTSW 4 125707897 missense probably benign 0.00
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGAACTGATGCCCAAAGCTC -3'
(R):5'- ACAGCTCTTCGTCACAGTTC -3'

Sequencing Primer
(F):5'- GATGCCCAAAGCTCTGTCTAC -3'
(R):5'- GGAGCAGAGCTCTGATTT -3'
Posted On 2016-07-22