Incidental Mutation 'R5318:Grin2b'
ID 405920
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 042901-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5318 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 135713233-136173511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135733918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 877 (I877V)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: I877V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I877V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: I877V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I877V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,567,986 (GRCm38) E74K possibly damaging Het
Anapc15 C T 7: 101,898,603 (GRCm38) P68L probably damaging Het
Ankfn1 A G 11: 89,391,928 (GRCm38) S298P probably damaging Het
Arfgef2 A C 2: 166,873,971 (GRCm38) K1393N probably damaging Het
Atp4a T A 7: 30,715,329 (GRCm38) V181E probably damaging Het
Bin3 A G 14: 70,134,512 (GRCm38) D134G possibly damaging Het
Cabs1 A G 5: 87,980,566 (GRCm38) T359A possibly damaging Het
Cblb A T 16: 52,186,198 (GRCm38) K754N possibly damaging Het
Ccdc153 A T 9: 44,245,765 (GRCm38) R135* probably null Het
Cel T C 2: 28,557,708 (GRCm38) E398G possibly damaging Het
Clip1 G A 5: 123,613,084 (GRCm38) probably benign Het
Dnase2b C A 3: 146,582,455 (GRCm38) R295L probably benign Het
Dnm3 G A 1: 162,011,807 (GRCm38) Q194* probably null Het
Dtx2 T A 5: 136,012,100 (GRCm38) S120T possibly damaging Het
Fat3 A T 9: 16,376,629 (GRCm38) S533T probably damaging Het
Foxred2 T C 15: 77,952,398 (GRCm38) I306V probably benign Het
Gdpd5 A T 7: 99,453,027 (GRCm38) T278S probably benign Het
Gli2 T A 1: 118,844,470 (GRCm38) T502S probably damaging Het
Gm10436 A T 12: 88,176,228 (GRCm38) C207S probably benign Het
Gm21830 A T 2: 67,432,814 (GRCm38) probably null Het
Gm38394 A G 1: 133,658,115 (GRCm38) S495P possibly damaging Het
Gm5617 T A 9: 48,495,911 (GRCm38) I115N possibly damaging Het
Gpr75 G T 11: 30,892,459 (GRCm38) A455S probably benign Het
Grik3 A G 4: 125,694,136 (GRCm38) E683G probably damaging Het
Gsg1l2 G T 11: 67,782,521 (GRCm38) C109F possibly damaging Het
H2-Q4 G A 17: 35,383,311 (GRCm38) V341I possibly damaging Het
Hjurp GT GTT 1: 88,266,524 (GRCm38) probably null Het
Kif5c A G 2: 49,671,828 (GRCm38) K68R probably benign Het
Lct T A 1: 128,304,372 (GRCm38) H580L probably damaging Het
Lrrtm4 A G 6: 80,022,512 (GRCm38) I302M probably damaging Het
Mef2b A T 8: 70,166,843 (GRCm38) R228W probably damaging Het
Mtus2 T A 5: 148,076,572 (GRCm38) D58E probably benign Het
Myh15 T G 16: 49,110,471 (GRCm38) S603A probably damaging Het
Olfr26 C T 9: 38,855,448 (GRCm38) P129S probably damaging Het
Olfr283 A G 15: 98,378,642 (GRCm38) I156T possibly damaging Het
Olfr54 T C 11: 51,027,593 (GRCm38) V197A probably benign Het
P2rx4 G A 5: 122,719,148 (GRCm38) C149Y probably null Het
Proca1 T A 11: 78,201,857 (GRCm38) V43E possibly damaging Het
Rftn1 G T 17: 49,994,458 (GRCm38) N454K probably benign Het
Rrp15 T C 1: 186,721,546 (GRCm38) T235A probably benign Het
Serpina6 T C 12: 103,653,962 (GRCm38) E176G possibly damaging Het
Shprh T G 10: 11,166,557 (GRCm38) I761M probably benign Het
Smg1 A T 7: 118,160,204 (GRCm38) probably benign Het
Snupn T C 9: 56,957,061 (GRCm38) S15P probably damaging Het
Tbc1d15 A T 10: 115,208,969 (GRCm38) Y509* probably null Het
Tcf4 T C 18: 69,465,430 (GRCm38) V72A probably benign Het
Tdrd3 T C 14: 87,477,463 (GRCm38) probably null Het
Tm9sf4 T A 2: 153,187,656 (GRCm38) V175D probably benign Het
Vmn1r201 T C 13: 22,474,922 (GRCm38) L102P probably damaging Het
Wdfy4 T A 14: 33,078,343 (GRCm38) N1788I possibly damaging Het
Xpc A C 6: 91,493,010 (GRCm38) V744G probably damaging Het
Xrcc6 T C 15: 82,037,507 (GRCm38) F178L probably damaging Het
Zfyve26 A G 12: 79,270,850 (GRCm38) V1196A probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,736,331 (GRCm38) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,733,570 (GRCm38) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,736,363 (GRCm38) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,044,265 (GRCm38) missense probably null 0.99
IGL01719:Grin2b APN 6 135,733,381 (GRCm38) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,733,740 (GRCm38) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,732,586 (GRCm38) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,736,472 (GRCm38) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,739,090 (GRCm38) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,043,908 (GRCm38) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,923,391 (GRCm38) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,779,369 (GRCm38) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,922,998 (GRCm38) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,739,132 (GRCm38) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,739,115 (GRCm38) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,780,255 (GRCm38) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0164:Grin2b UTSW 6 135,778,648 (GRCm38) splice site probably benign
R0194:Grin2b UTSW 6 135,779,305 (GRCm38) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,733,929 (GRCm38) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,843,195 (GRCm38) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,044,046 (GRCm38) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,732,732 (GRCm38) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,044,211 (GRCm38) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,733,245 (GRCm38) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,733,896 (GRCm38) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,780,140 (GRCm38) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,778,700 (GRCm38) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,733,182 (GRCm38) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,733,429 (GRCm38) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,740,953 (GRCm38) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,732,455 (GRCm38) small deletion probably benign
R3418:Grin2b UTSW 6 135,843,110 (GRCm38) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,923,271 (GRCm38) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,736,435 (GRCm38) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,778,741 (GRCm38) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,733,825 (GRCm38) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,774,872 (GRCm38) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,778,699 (GRCm38) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,733,407 (GRCm38) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,779,395 (GRCm38) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,732,441 (GRCm38) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,923,299 (GRCm38) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,779,342 (GRCm38) missense probably damaging 1.00
R5349:Grin2b UTSW 6 136,044,283 (GRCm38) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,732,368 (GRCm38) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,733,723 (GRCm38) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,923,397 (GRCm38) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,733,087 (GRCm38) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,740,964 (GRCm38) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,736,373 (GRCm38) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,733,944 (GRCm38) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,923,458 (GRCm38) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,772,399 (GRCm38) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,733,027 (GRCm38) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,780,279 (GRCm38) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,740,967 (GRCm38) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,733,344 (GRCm38) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,740,998 (GRCm38) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,732,551 (GRCm38) missense probably benign
R6647:Grin2b UTSW 6 135,733,110 (GRCm38) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,774,828 (GRCm38) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,780,200 (GRCm38) missense probably benign
R7033:Grin2b UTSW 6 135,923,038 (GRCm38) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,780,306 (GRCm38) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,733,476 (GRCm38) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,732,948 (GRCm38) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,780,251 (GRCm38) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,740,949 (GRCm38) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,772,396 (GRCm38) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,779,303 (GRCm38) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,923,364 (GRCm38) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,732,555 (GRCm38) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,778,794 (GRCm38) nonsense probably null
R8058:Grin2b UTSW 6 135,733,227 (GRCm38) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,733,488 (GRCm38) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,732,499 (GRCm38) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,923,076 (GRCm38) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,922,969 (GRCm38) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,733,916 (GRCm38) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,922,987 (GRCm38) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,044,009 (GRCm38) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9076:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9172:Grin2b UTSW 6 135,779,257 (GRCm38) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,733,401 (GRCm38) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,922,870 (GRCm38) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,044,240 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGGTGGGTTATTGTACGAC -3'
(R):5'- GAATTCAGCAAACTGCCTGC -3'

Sequencing Primer
(F):5'- ACGACTTGCAGTCTGAATGC -3'
(R):5'- AAACTGCCTGCCTCACGATTC -3'
Posted On 2016-07-22