Mutagenetix > Incidental Mutation

Incidental Mutation 'R5318:Atp4a'

405922

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

042901-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R5318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30715329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 181 (V181E)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005692
AA Change: V181E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: V181E

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably damaging
Transcript: ENSMUST00000170371
AA Change: V181E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: V181E

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	G	A	17: 35,567,986	E74K	possibly damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ankfn1	A	G	11: 89,391,928	S298P	probably damaging	Het
Arfgef2	A	C	2: 166,873,971	K1393N	probably damaging	Het
Bin3	A	G	14: 70,134,512	D134G	possibly damaging	Het
Cabs1	A	G	5: 87,980,566	T359A	possibly damaging	Het
Cblb	A	T	16: 52,186,198	K754N	possibly damaging	Het
Ccdc153	A	T	9: 44,245,765	R135*	probably null	Het
Cel	T	C	2: 28,557,708	E398G	possibly damaging	Het
Clip1	G	A	5: 123,613,084		probably benign	Het
Dnase2b	C	A	3: 146,582,455	R295L	probably benign	Het
Dnm3	G	A	1: 162,011,807	Q194*	probably null	Het
Dtx2	T	A	5: 136,012,100	S120T	possibly damaging	Het
Fat3	A	T	9: 16,376,629	S533T	probably damaging	Het
Foxred2	T	C	15: 77,952,398	I306V	probably benign	Het
Gdpd5	A	T	7: 99,453,027	T278S	probably benign	Het
Gli2	T	A	1: 118,844,470	T502S	probably damaging	Het
Gm10436	A	T	12: 88,176,228	C207S	probably benign	Het
Gm21830	A	T	2: 67,432,814		probably null	Het
Gm38394	A	G	1: 133,658,115	S495P	possibly damaging	Het
Gm5617	T	A	9: 48,495,911	I115N	possibly damaging	Het
Gpr75	G	T	11: 30,892,459	A455S	probably benign	Het
Grik3	A	G	4: 125,694,136	E683G	probably damaging	Het
Grin2b	T	C	6: 135,733,918	I877V	probably damaging	Het
Gsg1l2	G	T	11: 67,782,521	C109F	possibly damaging	Het
H2-Q4	G	A	17: 35,383,311	V341I	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Kif5c	A	G	2: 49,671,828	K68R	probably benign	Het
Lct	T	A	1: 128,304,372	H580L	probably damaging	Het
Lrrtm4	A	G	6: 80,022,512	I302M	probably damaging	Het
Mef2b	A	T	8: 70,166,843	R228W	probably damaging	Het
Mtus2	T	A	5: 148,076,572	D58E	probably benign	Het
Myh15	T	G	16: 49,110,471	S603A	probably damaging	Het
Olfr26	C	T	9: 38,855,448	P129S	probably damaging	Het
Olfr283	A	G	15: 98,378,642	I156T	possibly damaging	Het
Olfr54	T	C	11: 51,027,593	V197A	probably benign	Het
P2rx4	G	A	5: 122,719,148	C149Y	probably null	Het
Proca1	T	A	11: 78,201,857	V43E	possibly damaging	Het
Rftn1	G	T	17: 49,994,458	N454K	probably benign	Het
Rrp15	T	C	1: 186,721,546	T235A	probably benign	Het
Serpina6	T	C	12: 103,653,962	E176G	possibly damaging	Het
Shprh	T	G	10: 11,166,557	I761M	probably benign	Het
Smg1	A	T	7: 118,160,204		probably benign	Het
Snupn	T	C	9: 56,957,061	S15P	probably damaging	Het
Tbc1d15	A	T	10: 115,208,969	Y509*	probably null	Het
Tcf4	T	C	18: 69,465,430	V72A	probably benign	Het
Tdrd3	T	C	14: 87,477,463		probably null	Het
Tm9sf4	T	A	2: 153,187,656	V175D	probably benign	Het
Vmn1r201	T	C	13: 22,474,922	L102P	probably damaging	Het
Wdfy4	T	A	14: 33,078,343	N1788I	possibly damaging	Het
Xpc	A	C	6: 91,493,010	V744G	probably damaging	Het
Xrcc6	T	C	15: 82,037,507	F178L	probably damaging	Het
Zfyve26	A	G	12: 79,270,850	V1196A	probably benign	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACACCTTGAGCCATCTCC -3'
(R):5'- CAAGGGGACTCTCATGTGTAC -3'

Sequencing Primer
(F):5'- GAGCCATCTCCTGCCATCATC -3'
(R):5'- GGGACTCTCATGTGTACACTCG -3'

Posted On

2016-07-22