Incidental Mutation 'R5318:Atp4a'
ID 405922
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
MMRRC Submission 042901-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5318 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30414754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 181 (V181E)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005692
AA Change: V181E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: V181E

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably damaging
Transcript: ENSMUST00000170371
AA Change: V181E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: V181E

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,878,883 (GRCm39) E74K possibly damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Ankfn1 A G 11: 89,282,754 (GRCm39) S298P probably damaging Het
Arfgef2 A C 2: 166,715,891 (GRCm39) K1393N probably damaging Het
Bin3 A G 14: 70,371,961 (GRCm39) D134G possibly damaging Het
Cabs1 A G 5: 88,128,425 (GRCm39) T359A possibly damaging Het
Cblb A T 16: 52,006,561 (GRCm39) K754N possibly damaging Het
Ccdc153 A T 9: 44,157,062 (GRCm39) R135* probably null Het
Cel T C 2: 28,447,720 (GRCm39) E398G possibly damaging Het
Clip1 G A 5: 123,751,147 (GRCm39) probably benign Het
Dnase2b C A 3: 146,288,210 (GRCm39) R295L probably benign Het
Dnm3 G A 1: 161,839,376 (GRCm39) Q194* probably null Het
Dtx2 T A 5: 136,040,954 (GRCm39) S120T possibly damaging Het
Fat3 A T 9: 16,287,925 (GRCm39) S533T probably damaging Het
Foxred2 T C 15: 77,836,598 (GRCm39) I306V probably benign Het
Gdpd5 A T 7: 99,102,234 (GRCm39) T278S probably benign Het
Gli2 T A 1: 118,772,200 (GRCm39) T502S probably damaging Het
Gm21830 A T 2: 67,263,158 (GRCm39) probably null Het
Gm5617 T A 9: 48,407,211 (GRCm39) I115N possibly damaging Het
Gpr75 G T 11: 30,842,459 (GRCm39) A455S probably benign Het
Grik3 A G 4: 125,587,929 (GRCm39) E683G probably damaging Het
Grin2b T C 6: 135,710,916 (GRCm39) I877V probably damaging Het
Gsg1l2 G T 11: 67,673,347 (GRCm39) C109F possibly damaging Het
H2-Q4 G A 17: 35,602,287 (GRCm39) V341I possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Kif5c A G 2: 49,561,840 (GRCm39) K68R probably benign Het
Lct T A 1: 128,232,109 (GRCm39) H580L probably damaging Het
Lrrtm4 A G 6: 79,999,495 (GRCm39) I302M probably damaging Het
Mef2b A T 8: 70,619,493 (GRCm39) R228W probably damaging Het
Mtus2 T A 5: 148,013,382 (GRCm39) D58E probably benign Het
Myh15 T G 16: 48,930,834 (GRCm39) S603A probably damaging Het
Or1x2 T C 11: 50,918,420 (GRCm39) V197A probably benign Het
Or8d1 C T 9: 38,766,744 (GRCm39) P129S probably damaging Het
Or8s2 A G 15: 98,276,523 (GRCm39) I156T possibly damaging Het
P2rx4 G A 5: 122,857,211 (GRCm39) C149Y probably null Het
Pramel51 A T 12: 88,142,998 (GRCm39) C207S probably benign Het
Proca1 T A 11: 78,092,683 (GRCm39) V43E possibly damaging Het
Rftn1 G T 17: 50,301,486 (GRCm39) N454K probably benign Het
Rrp15 T C 1: 186,453,743 (GRCm39) T235A probably benign Het
Serpina6 T C 12: 103,620,221 (GRCm39) E176G possibly damaging Het
Shprh T G 10: 11,042,301 (GRCm39) I761M probably benign Het
Smg1 A T 7: 117,759,427 (GRCm39) probably benign Het
Snupn T C 9: 56,864,345 (GRCm39) S15P probably damaging Het
Tbc1d15 A T 10: 115,044,874 (GRCm39) Y509* probably null Het
Tcf4 T C 18: 69,598,501 (GRCm39) V72A probably benign Het
Tdrd3 T C 14: 87,714,899 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,029,576 (GRCm39) V175D probably benign Het
Vmn1r201 T C 13: 22,659,092 (GRCm39) L102P probably damaging Het
Wdfy4 T A 14: 32,800,300 (GRCm39) N1788I possibly damaging Het
Xpc A C 6: 91,469,992 (GRCm39) V744G probably damaging Het
Xrcc6 T C 15: 81,921,708 (GRCm39) F178L probably damaging Het
Zbed6 A G 1: 133,585,853 (GRCm39) S495P possibly damaging Het
Zfyve26 A G 12: 79,317,624 (GRCm39) V1196A probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30,422,462 (GRCm39) missense probably benign 0.14
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0140:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30,414,802 (GRCm39) missense probably damaging 0.98
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R7762:Atp4a UTSW 7 30,419,461 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30,416,782 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACACCTTGAGCCATCTCC -3'
(R):5'- CAAGGGGACTCTCATGTGTAC -3'

Sequencing Primer
(F):5'- GAGCCATCTCCTGCCATCATC -3'
(R):5'- GGGACTCTCATGTGTACACTCG -3'
Posted On 2016-07-22