Incidental Mutation 'R5318:Smg1'
ID 405925
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik, C130002K18Rik
MMRRC Submission 042901-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5318 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 117730531-117842893 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to T at 117759427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: F2140I
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: F2140I

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208025
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,878,883 (GRCm39) E74K possibly damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Ankfn1 A G 11: 89,282,754 (GRCm39) S298P probably damaging Het
Arfgef2 A C 2: 166,715,891 (GRCm39) K1393N probably damaging Het
Atp4a T A 7: 30,414,754 (GRCm39) V181E probably damaging Het
Bin3 A G 14: 70,371,961 (GRCm39) D134G possibly damaging Het
Cabs1 A G 5: 88,128,425 (GRCm39) T359A possibly damaging Het
Cblb A T 16: 52,006,561 (GRCm39) K754N possibly damaging Het
Ccdc153 A T 9: 44,157,062 (GRCm39) R135* probably null Het
Cel T C 2: 28,447,720 (GRCm39) E398G possibly damaging Het
Clip1 G A 5: 123,751,147 (GRCm39) probably benign Het
Dnase2b C A 3: 146,288,210 (GRCm39) R295L probably benign Het
Dnm3 G A 1: 161,839,376 (GRCm39) Q194* probably null Het
Dtx2 T A 5: 136,040,954 (GRCm39) S120T possibly damaging Het
Fat3 A T 9: 16,287,925 (GRCm39) S533T probably damaging Het
Foxred2 T C 15: 77,836,598 (GRCm39) I306V probably benign Het
Gdpd5 A T 7: 99,102,234 (GRCm39) T278S probably benign Het
Gli2 T A 1: 118,772,200 (GRCm39) T502S probably damaging Het
Gm21830 A T 2: 67,263,158 (GRCm39) probably null Het
Gm5617 T A 9: 48,407,211 (GRCm39) I115N possibly damaging Het
Gpr75 G T 11: 30,842,459 (GRCm39) A455S probably benign Het
Grik3 A G 4: 125,587,929 (GRCm39) E683G probably damaging Het
Grin2b T C 6: 135,710,916 (GRCm39) I877V probably damaging Het
Gsg1l2 G T 11: 67,673,347 (GRCm39) C109F possibly damaging Het
H2-Q4 G A 17: 35,602,287 (GRCm39) V341I possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Kif5c A G 2: 49,561,840 (GRCm39) K68R probably benign Het
Lct T A 1: 128,232,109 (GRCm39) H580L probably damaging Het
Lrrtm4 A G 6: 79,999,495 (GRCm39) I302M probably damaging Het
Mef2b A T 8: 70,619,493 (GRCm39) R228W probably damaging Het
Mtus2 T A 5: 148,013,382 (GRCm39) D58E probably benign Het
Myh15 T G 16: 48,930,834 (GRCm39) S603A probably damaging Het
Or1x2 T C 11: 50,918,420 (GRCm39) V197A probably benign Het
Or8d1 C T 9: 38,766,744 (GRCm39) P129S probably damaging Het
Or8s2 A G 15: 98,276,523 (GRCm39) I156T possibly damaging Het
P2rx4 G A 5: 122,857,211 (GRCm39) C149Y probably null Het
Pramel51 A T 12: 88,142,998 (GRCm39) C207S probably benign Het
Proca1 T A 11: 78,092,683 (GRCm39) V43E possibly damaging Het
Rftn1 G T 17: 50,301,486 (GRCm39) N454K probably benign Het
Rrp15 T C 1: 186,453,743 (GRCm39) T235A probably benign Het
Serpina6 T C 12: 103,620,221 (GRCm39) E176G possibly damaging Het
Shprh T G 10: 11,042,301 (GRCm39) I761M probably benign Het
Snupn T C 9: 56,864,345 (GRCm39) S15P probably damaging Het
Tbc1d15 A T 10: 115,044,874 (GRCm39) Y509* probably null Het
Tcf4 T C 18: 69,598,501 (GRCm39) V72A probably benign Het
Tdrd3 T C 14: 87,714,899 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,029,576 (GRCm39) V175D probably benign Het
Vmn1r201 T C 13: 22,659,092 (GRCm39) L102P probably damaging Het
Wdfy4 T A 14: 32,800,300 (GRCm39) N1788I possibly damaging Het
Xpc A C 6: 91,469,992 (GRCm39) V744G probably damaging Het
Xrcc6 T C 15: 81,921,708 (GRCm39) F178L probably damaging Het
Zbed6 A G 1: 133,585,853 (GRCm39) S495P possibly damaging Het
Zfyve26 A G 12: 79,317,624 (GRCm39) V1196A probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 117,797,494 (GRCm39) utr 3 prime probably benign
IGL00481:Smg1 APN 7 117,810,017 (GRCm39) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 117,784,706 (GRCm39) utr 3 prime probably benign
IGL00927:Smg1 APN 7 117,739,855 (GRCm39) missense probably damaging 1.00
IGL01333:Smg1 APN 7 117,762,601 (GRCm39) splice site probably benign
IGL01344:Smg1 APN 7 117,790,059 (GRCm39) utr 3 prime probably benign
IGL01397:Smg1 APN 7 117,762,444 (GRCm39) utr 3 prime probably benign
IGL01403:Smg1 APN 7 117,757,355 (GRCm39) utr 3 prime probably benign
IGL01573:Smg1 APN 7 117,767,185 (GRCm39) utr 3 prime probably benign
IGL01872:Smg1 APN 7 117,748,167 (GRCm39) utr 3 prime probably benign
IGL02010:Smg1 APN 7 117,785,369 (GRCm39) utr 3 prime probably benign
IGL02158:Smg1 APN 7 117,812,169 (GRCm39) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 117,781,764 (GRCm39) missense probably benign 0.19
IGL02314:Smg1 APN 7 117,753,932 (GRCm39) utr 3 prime probably benign
IGL02552:Smg1 APN 7 117,795,117 (GRCm39) utr 3 prime probably benign
IGL02577:Smg1 APN 7 117,802,345 (GRCm39) missense probably damaging 0.99
IGL02859:Smg1 APN 7 117,748,156 (GRCm39) utr 3 prime probably benign
IGL02890:Smg1 APN 7 117,784,724 (GRCm39) utr 3 prime probably benign
IGL02892:Smg1 APN 7 117,767,178 (GRCm39) utr 3 prime probably benign
IGL03119:Smg1 APN 7 117,794,336 (GRCm39) utr 3 prime probably benign
IGL03123:Smg1 APN 7 117,756,404 (GRCm39) utr 3 prime probably benign
IGL03128:Smg1 APN 7 117,802,282 (GRCm39) missense probably benign 0.03
IGL03184:Smg1 APN 7 117,779,603 (GRCm39) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 117,784,764 (GRCm39) missense unknown
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 117,744,690 (GRCm39) missense probably benign 0.02
R0139:Smg1 UTSW 7 117,751,898 (GRCm39) critical splice donor site probably null
R0371:Smg1 UTSW 7 117,767,523 (GRCm39) utr 3 prime probably benign
R0415:Smg1 UTSW 7 117,781,691 (GRCm39) missense probably benign 0.34
R0416:Smg1 UTSW 7 117,783,684 (GRCm39) splice site probably benign
R0423:Smg1 UTSW 7 117,776,103 (GRCm39) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 117,759,606 (GRCm39) utr 3 prime probably benign
R0626:Smg1 UTSW 7 117,781,606 (GRCm39) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 117,767,084 (GRCm39) utr 3 prime probably benign
R0727:Smg1 UTSW 7 117,765,645 (GRCm39) utr 3 prime probably benign
R0729:Smg1 UTSW 7 117,745,512 (GRCm39) utr 3 prime probably benign
R0841:Smg1 UTSW 7 117,742,524 (GRCm39) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 117,759,013 (GRCm39) utr 3 prime probably benign
R1256:Smg1 UTSW 7 117,802,310 (GRCm39) missense probably damaging 1.00
R1298:Smg1 UTSW 7 117,767,434 (GRCm39) utr 3 prime probably benign
R1370:Smg1 UTSW 7 117,758,975 (GRCm39) utr 3 prime probably benign
R1591:Smg1 UTSW 7 117,756,142 (GRCm39) utr 3 prime probably benign
R1736:Smg1 UTSW 7 117,765,190 (GRCm39) splice site probably null
R1755:Smg1 UTSW 7 117,802,287 (GRCm39) nonsense probably null
R1765:Smg1 UTSW 7 117,738,938 (GRCm39) missense probably benign 0.03
R1789:Smg1 UTSW 7 117,745,021 (GRCm39) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 117,753,845 (GRCm39) utr 3 prime probably benign
R1908:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1909:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1942:Smg1 UTSW 7 117,757,326 (GRCm39) utr 3 prime probably benign
R2064:Smg1 UTSW 7 117,756,090 (GRCm39) utr 3 prime probably benign
R2072:Smg1 UTSW 7 117,762,389 (GRCm39) utr 3 prime probably benign
R2154:Smg1 UTSW 7 117,757,299 (GRCm39) utr 3 prime probably benign
R2895:Smg1 UTSW 7 117,788,366 (GRCm39) utr 3 prime probably benign
R2915:Smg1 UTSW 7 117,810,102 (GRCm39) splice site probably benign
R3416:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3417:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3873:Smg1 UTSW 7 117,753,885 (GRCm39) utr 3 prime probably benign
R4082:Smg1 UTSW 7 117,759,469 (GRCm39) utr 3 prime probably benign
R4230:Smg1 UTSW 7 117,747,956 (GRCm39) critical splice donor site probably null
R4304:Smg1 UTSW 7 117,738,741 (GRCm39) missense probably benign 0.03
R4549:Smg1 UTSW 7 117,758,906 (GRCm39) utr 3 prime probably benign
R4571:Smg1 UTSW 7 117,738,688 (GRCm39) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 117,795,149 (GRCm39) utr 3 prime probably benign
R4642:Smg1 UTSW 7 117,753,487 (GRCm39) utr 3 prime probably benign
R4656:Smg1 UTSW 7 117,812,174 (GRCm39) missense probably benign 0.00
R4754:Smg1 UTSW 7 117,755,954 (GRCm39) utr 3 prime probably benign
R4798:Smg1 UTSW 7 117,779,697 (GRCm39) missense probably benign 0.32
R4906:Smg1 UTSW 7 117,751,631 (GRCm39) utr 3 prime probably benign
R4978:Smg1 UTSW 7 117,753,470 (GRCm39) utr 3 prime probably benign
R4989:Smg1 UTSW 7 117,807,274 (GRCm39) missense probably benign
R4989:Smg1 UTSW 7 117,757,323 (GRCm39) utr 3 prime probably benign
R5026:Smg1 UTSW 7 117,792,768 (GRCm39) utr 3 prime probably benign
R5124:Smg1 UTSW 7 117,812,235 (GRCm39) missense probably benign 0.00
R5356:Smg1 UTSW 7 117,794,356 (GRCm39) utr 3 prime probably benign
R5404:Smg1 UTSW 7 117,806,131 (GRCm39) missense probably damaging 1.00
R5423:Smg1 UTSW 7 117,745,294 (GRCm39) missense possibly damaging 0.70
R5441:Smg1 UTSW 7 117,794,304 (GRCm39) utr 3 prime probably benign
R5490:Smg1 UTSW 7 117,738,659 (GRCm39) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 117,756,386 (GRCm39) utr 3 prime probably benign
R5564:Smg1 UTSW 7 117,789,042 (GRCm39) utr 3 prime probably benign
R5580:Smg1 UTSW 7 117,748,125 (GRCm39) utr 3 prime probably benign
R5600:Smg1 UTSW 7 117,767,107 (GRCm39) utr 3 prime probably benign
R5628:Smg1 UTSW 7 117,753,924 (GRCm39) utr 3 prime probably benign
R5646:Smg1 UTSW 7 117,811,782 (GRCm39) missense probably benign 0.42
R5656:Smg1 UTSW 7 117,753,887 (GRCm39) utr 3 prime probably benign
R5660:Smg1 UTSW 7 117,742,570 (GRCm39) missense probably benign 0.33
R5706:Smg1 UTSW 7 117,744,813 (GRCm39) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 117,812,120 (GRCm39) missense probably benign 0.12
R5890:Smg1 UTSW 7 117,789,809 (GRCm39) utr 3 prime probably benign
R5912:Smg1 UTSW 7 117,753,809 (GRCm39) utr 3 prime probably benign
R5977:Smg1 UTSW 7 117,740,580 (GRCm39) utr 3 prime probably benign
R5993:Smg1 UTSW 7 117,739,732 (GRCm39) missense probably benign 0.33
R6161:Smg1 UTSW 7 117,762,553 (GRCm39) utr 3 prime probably benign
R6187:Smg1 UTSW 7 117,788,386 (GRCm39) utr 3 prime probably benign
R6264:Smg1 UTSW 7 117,765,310 (GRCm39) utr 3 prime probably benign
R6331:Smg1 UTSW 7 117,753,500 (GRCm39) utr 3 prime probably benign
R6561:Smg1 UTSW 7 117,765,300 (GRCm39) utr 3 prime probably benign
R6571:Smg1 UTSW 7 117,783,737 (GRCm39) utr 3 prime probably benign
R6736:Smg1 UTSW 7 117,756,389 (GRCm39) utr 3 prime probably benign
R6752:Smg1 UTSW 7 117,762,539 (GRCm39) utr 3 prime probably benign
R6777:Smg1 UTSW 7 117,788,340 (GRCm39) utr 3 prime probably benign
R6788:Smg1 UTSW 7 117,783,794 (GRCm39) utr 3 prime probably benign
R6883:Smg1 UTSW 7 117,767,403 (GRCm39) utr 3 prime probably benign
R6991:Smg1 UTSW 7 117,767,091 (GRCm39) utr 3 prime probably benign
R7056:Smg1 UTSW 7 117,745,623 (GRCm39) splice site probably benign
R7058:Smg1 UTSW 7 117,797,502 (GRCm39) utr 3 prime probably benign
R7100:Smg1 UTSW 7 117,783,743 (GRCm39) missense unknown
R7133:Smg1 UTSW 7 117,752,131 (GRCm39) missense unknown
R7221:Smg1 UTSW 7 117,782,020 (GRCm39) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 117,776,178 (GRCm39) missense probably benign 0.03
R7293:Smg1 UTSW 7 117,765,322 (GRCm39) missense unknown
R7361:Smg1 UTSW 7 117,784,200 (GRCm39) missense unknown
R7438:Smg1 UTSW 7 117,795,116 (GRCm39) missense unknown
R7686:Smg1 UTSW 7 117,767,081 (GRCm39) missense unknown
R7798:Smg1 UTSW 7 117,771,162 (GRCm39) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 117,785,357 (GRCm39) missense unknown
R7923:Smg1 UTSW 7 117,742,545 (GRCm39) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 117,792,878 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,365 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,364 (GRCm39) missense unknown
R8025:Smg1 UTSW 7 117,806,212 (GRCm39) nonsense probably null
R8056:Smg1 UTSW 7 117,759,589 (GRCm39) missense unknown
R8061:Smg1 UTSW 7 117,751,610 (GRCm39) missense unknown
R8095:Smg1 UTSW 7 117,772,285 (GRCm39) missense unknown
R8198:Smg1 UTSW 7 117,744,829 (GRCm39) missense probably benign 0.03
R8399:Smg1 UTSW 7 117,789,794 (GRCm39) missense unknown
R8445:Smg1 UTSW 7 117,736,200 (GRCm39) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 117,770,982 (GRCm39) utr 3 prime probably benign
R8817:Smg1 UTSW 7 117,758,887 (GRCm39) missense unknown
R8832:Smg1 UTSW 7 117,739,006 (GRCm39) missense probably benign 0.33
R8855:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8866:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8946:Smg1 UTSW 7 117,751,900 (GRCm39) missense probably null
R8954:Smg1 UTSW 7 117,806,215 (GRCm39) missense probably damaging 1.00
R8967:Smg1 UTSW 7 117,765,739 (GRCm39) missense unknown
R9072:Smg1 UTSW 7 117,783,032 (GRCm39) missense unknown
R9090:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9156:Smg1 UTSW 7 117,753,884 (GRCm39) missense unknown
R9198:Smg1 UTSW 7 117,795,179 (GRCm39) missense unknown
R9240:Smg1 UTSW 7 117,739,031 (GRCm39) missense probably benign 0.18
R9271:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9289:Smg1 UTSW 7 117,744,639 (GRCm39) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 117,777,998 (GRCm39) nonsense probably null
R9396:Smg1 UTSW 7 117,807,303 (GRCm39) missense unknown
R9469:Smg1 UTSW 7 117,739,774 (GRCm39) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 117,744,976 (GRCm39) missense probably benign 0.03
R9549:Smg1 UTSW 7 117,795,254 (GRCm39) missense unknown
R9563:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9564:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9597:Smg1 UTSW 7 117,812,270 (GRCm39) missense unknown
R9643:Smg1 UTSW 7 117,755,933 (GRCm39) missense unknown
R9703:Smg1 UTSW 7 117,739,744 (GRCm39) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 117,783,004 (GRCm39) missense unknown
Z1088:Smg1 UTSW 7 117,777,622 (GRCm39) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 117,767,884 (GRCm39) nonsense probably null
Z1088:Smg1 UTSW 7 117,753,858 (GRCm39) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 117,806,130 (GRCm39) missense unknown
Z1176:Smg1 UTSW 7 117,806,110 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,812,256 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,767,831 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTTGTACTTGCAAGGTGC -3'
(R):5'- TTTGCAACAGAGAGCGCAG -3'

Sequencing Primer
(F):5'- TCATTCAAAATCACATAGGTCACAAG -3'
(R):5'- GAAACGAGCAAGCTACATCTTG -3'
Posted On 2016-07-22