Incidental Mutation 'R5318:Shprh'
ID 405934
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 042901-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5318 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 11166557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 761 (I761M)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
AlphaFold Q7TPQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: I761M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: I761M

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: I761M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: I761M

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: I761M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: I761M

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: I761M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: I761M

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160461
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,567,986 E74K possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankfn1 A G 11: 89,391,928 S298P probably damaging Het
Arfgef2 A C 2: 166,873,971 K1393N probably damaging Het
Atp4a T A 7: 30,715,329 V181E probably damaging Het
Bin3 A G 14: 70,134,512 D134G possibly damaging Het
Cabs1 A G 5: 87,980,566 T359A possibly damaging Het
Cblb A T 16: 52,186,198 K754N possibly damaging Het
Ccdc153 A T 9: 44,245,765 R135* probably null Het
Cel T C 2: 28,557,708 E398G possibly damaging Het
Clip1 G A 5: 123,613,084 probably benign Het
Dnase2b C A 3: 146,582,455 R295L probably benign Het
Dnm3 G A 1: 162,011,807 Q194* probably null Het
Dtx2 T A 5: 136,012,100 S120T possibly damaging Het
Fat3 A T 9: 16,376,629 S533T probably damaging Het
Foxred2 T C 15: 77,952,398 I306V probably benign Het
Gdpd5 A T 7: 99,453,027 T278S probably benign Het
Gli2 T A 1: 118,844,470 T502S probably damaging Het
Gm10436 A T 12: 88,176,228 C207S probably benign Het
Gm21830 A T 2: 67,432,814 probably null Het
Gm38394 A G 1: 133,658,115 S495P possibly damaging Het
Gm5617 T A 9: 48,495,911 I115N possibly damaging Het
Gpr75 G T 11: 30,892,459 A455S probably benign Het
Grik3 A G 4: 125,694,136 E683G probably damaging Het
Grin2b T C 6: 135,733,918 I877V probably damaging Het
Gsg1l2 G T 11: 67,782,521 C109F possibly damaging Het
H2-Q4 G A 17: 35,383,311 V341I possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kif5c A G 2: 49,671,828 K68R probably benign Het
Lct T A 1: 128,304,372 H580L probably damaging Het
Lrrtm4 A G 6: 80,022,512 I302M probably damaging Het
Mef2b A T 8: 70,166,843 R228W probably damaging Het
Mtus2 T A 5: 148,076,572 D58E probably benign Het
Myh15 T G 16: 49,110,471 S603A probably damaging Het
Olfr26 C T 9: 38,855,448 P129S probably damaging Het
Olfr283 A G 15: 98,378,642 I156T possibly damaging Het
Olfr54 T C 11: 51,027,593 V197A probably benign Het
P2rx4 G A 5: 122,719,148 C149Y probably null Het
Proca1 T A 11: 78,201,857 V43E possibly damaging Het
Rftn1 G T 17: 49,994,458 N454K probably benign Het
Rrp15 T C 1: 186,721,546 T235A probably benign Het
Serpina6 T C 12: 103,653,962 E176G possibly damaging Het
Smg1 A T 7: 118,160,204 probably benign Het
Snupn T C 9: 56,957,061 S15P probably damaging Het
Tbc1d15 A T 10: 115,208,969 Y509* probably null Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tdrd3 T C 14: 87,477,463 probably null Het
Tm9sf4 T A 2: 153,187,656 V175D probably benign Het
Vmn1r201 T C 13: 22,474,922 L102P probably damaging Het
Wdfy4 T A 14: 33,078,343 N1788I possibly damaging Het
Xpc A C 6: 91,493,010 V744G probably damaging Het
Xrcc6 T C 15: 82,037,507 F178L probably damaging Het
Zfyve26 A G 12: 79,270,850 V1196A probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
R9668:Shprh UTSW 10 11206332 missense probably damaging 0.97
R9709:Shprh UTSW 10 11162830 missense possibly damaging 0.91
R9718:Shprh UTSW 10 11213504 missense probably damaging 1.00
R9750:Shprh UTSW 10 11164460 missense probably damaging 0.98
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTCTCCAGACAGTTGTGCAATC -3'
(R):5'- CTGTAGGACACTCGACCATC -3'

Sequencing Primer
(F):5'- CAGACAGTTGTGCAATCTGTCTATAG -3'
(R):5'- TCTGAGCTTCATCAAGGCAG -3'
Posted On 2016-07-22