Incidental Mutation 'R5318:Cblb'
ID405952
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
MMRRC Submission 042901-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5318 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52186198 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 754 (K754N)
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
Predicted Effect probably benign
Transcript: ENSMUST00000114471
AA Change: K754N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: K754N

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000226593
AA Change: K754N

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000227062
AA Change: K754N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227756
AA Change: K602N

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227879
AA Change: K754N

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik G A 17: 35,567,986 E74K possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankfn1 A G 11: 89,391,928 S298P probably damaging Het
Arfgef2 A C 2: 166,873,971 K1393N probably damaging Het
Atp4a T A 7: 30,715,329 V181E probably damaging Het
Bin3 A G 14: 70,134,512 D134G possibly damaging Het
Cabs1 A G 5: 87,980,566 T359A possibly damaging Het
Ccdc153 A T 9: 44,245,765 R135* probably null Het
Cel T C 2: 28,557,708 E398G possibly damaging Het
Clip1 G A 5: 123,613,084 probably benign Het
Dnase2b C A 3: 146,582,455 R295L probably benign Het
Dnm3 G A 1: 162,011,807 Q194* probably null Het
Dtx2 T A 5: 136,012,100 S120T possibly damaging Het
Fat3 A T 9: 16,376,629 S533T probably damaging Het
Foxred2 T C 15: 77,952,398 I306V probably benign Het
Gdpd5 A T 7: 99,453,027 T278S probably benign Het
Gli2 T A 1: 118,844,470 T502S probably damaging Het
Gm10436 A T 12: 88,176,228 C207S probably benign Het
Gm21830 A T 2: 67,432,814 probably null Het
Gm38394 A G 1: 133,658,115 S495P possibly damaging Het
Gm5617 T A 9: 48,495,911 I115N possibly damaging Het
Gpr75 G T 11: 30,892,459 A455S probably benign Het
Grik3 A G 4: 125,694,136 E683G probably damaging Het
Grin2b T C 6: 135,733,918 I877V probably damaging Het
Gsg1l2 G T 11: 67,782,521 C109F possibly damaging Het
H2-Q4 G A 17: 35,383,311 V341I possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kif5c A G 2: 49,671,828 K68R probably benign Het
Lct T A 1: 128,304,372 H580L probably damaging Het
Lrrtm4 A G 6: 80,022,512 I302M probably damaging Het
Mef2b A T 8: 70,166,843 R228W probably damaging Het
Mtus2 T A 5: 148,076,572 D58E probably benign Het
Myh15 T G 16: 49,110,471 S603A probably damaging Het
Olfr26 C T 9: 38,855,448 P129S probably damaging Het
Olfr283 A G 15: 98,378,642 I156T possibly damaging Het
Olfr54 T C 11: 51,027,593 V197A probably benign Het
P2rx4 G A 5: 122,719,148 C149Y probably null Het
Proca1 T A 11: 78,201,857 V43E possibly damaging Het
Rftn1 G T 17: 49,994,458 N454K probably benign Het
Rrp15 T C 1: 186,721,546 T235A probably benign Het
Serpina6 T C 12: 103,653,962 E176G possibly damaging Het
Shprh T G 10: 11,166,557 I761M probably benign Het
Smg1 A T 7: 118,160,204 probably benign Het
Snupn T C 9: 56,957,061 S15P probably damaging Het
Tbc1d15 A T 10: 115,208,969 Y509* probably null Het
Tcf4 T C 18: 69,465,430 V72A possibly damaging Het
Tdrd3 T C 14: 87,477,463 probably null Het
Tm9sf4 T A 2: 153,187,656 V175D probably benign Het
Vmn1r201 T C 13: 22,474,922 L102P probably damaging Het
Wdfy4 T A 14: 33,078,343 N1788I possibly damaging Het
Xpc A C 6: 91,493,010 V744G probably damaging Het
Xrcc6 T C 15: 82,037,507 F178L probably damaging Het
Zfyve26 A G 12: 79,270,850 V1196A probably benign Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTACAGGTCAGGGTAGCTG -3'
(R):5'- TCAGAGGCTGAGTCAGAACCAC -3'

Sequencing Primer
(F):5'- AGCTGCATGTTGTTACTAGTCC -3'
(R):5'- TGAGTCAGAACCACCTCCTAGAG -3'
Posted On2016-07-22