Mutagenetix > Incidental Mutations

Incidental Mutation 'R5318:Rftn1'

405955

Institutional Source

Beutler Lab

Gene Symbol

Rftn1

Ensembl Gene

ENSMUSG00000039316

Gene Name

raftlin lipid raft linker 1

Synonyms

2310015N21Rik

MMRRC Submission

042901-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49992257-50190674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 49994458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 454 (N454K)

Ref Sequence

ENSEMBL: ENSMUSP00000046524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]

AlphaFold

Q6A0D4

Predicted Effect

probably benign
Transcript: ENSMUST00000044503
AA Change: N454K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: N454K

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	473	1.3e-219	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113195
AA Change: N176K

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: N176K

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	207	1.5e-104	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	G	A	17: 35,567,986	E74K	possibly damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Ankfn1	A	G	11: 89,391,928	S298P	probably damaging	Het
Arfgef2	A	C	2: 166,873,971	K1393N	probably damaging	Het
Atp4a	T	A	7: 30,715,329	V181E	probably damaging	Het
Bin3	A	G	14: 70,134,512	D134G	possibly damaging	Het
Cabs1	A	G	5: 87,980,566	T359A	possibly damaging	Het
Cblb	A	T	16: 52,186,198	K754N	possibly damaging	Het
Ccdc153	A	T	9: 44,245,765	R135*	probably null	Het
Cel	T	C	2: 28,557,708	E398G	possibly damaging	Het
Clip1	G	A	5: 123,613,084		probably benign	Het
Dnase2b	C	A	3: 146,582,455	R295L	probably benign	Het
Dnm3	G	A	1: 162,011,807	Q194*	probably null	Het
Dtx2	T	A	5: 136,012,100	S120T	possibly damaging	Het
Fat3	A	T	9: 16,376,629	S533T	probably damaging	Het
Foxred2	T	C	15: 77,952,398	I306V	probably benign	Het
Gdpd5	A	T	7: 99,453,027	T278S	probably benign	Het
Gli2	T	A	1: 118,844,470	T502S	probably damaging	Het
Gm10436	A	T	12: 88,176,228	C207S	probably benign	Het
Gm21830	A	T	2: 67,432,814		probably null	Het
Gm38394	A	G	1: 133,658,115	S495P	possibly damaging	Het
Gm5617	T	A	9: 48,495,911	I115N	possibly damaging	Het
Gpr75	G	T	11: 30,892,459	A455S	probably benign	Het
Grik3	A	G	4: 125,694,136	E683G	probably damaging	Het
Grin2b	T	C	6: 135,733,918	I877V	probably damaging	Het
Gsg1l2	G	T	11: 67,782,521	C109F	possibly damaging	Het
H2-Q4	G	A	17: 35,383,311	V341I	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Kif5c	A	G	2: 49,671,828	K68R	probably benign	Het
Lct	T	A	1: 128,304,372	H580L	probably damaging	Het
Lrrtm4	A	G	6: 80,022,512	I302M	probably damaging	Het
Mef2b	A	T	8: 70,166,843	R228W	probably damaging	Het
Mtus2	T	A	5: 148,076,572	D58E	probably benign	Het
Myh15	T	G	16: 49,110,471	S603A	probably damaging	Het
Olfr26	C	T	9: 38,855,448	P129S	probably damaging	Het
Olfr283	A	G	15: 98,378,642	I156T	possibly damaging	Het
Olfr54	T	C	11: 51,027,593	V197A	probably benign	Het
P2rx4	G	A	5: 122,719,148	C149Y	probably null	Het
Proca1	T	A	11: 78,201,857	V43E	possibly damaging	Het
Rrp15	T	C	1: 186,721,546	T235A	probably benign	Het
Serpina6	T	C	12: 103,653,962	E176G	possibly damaging	Het
Shprh	T	G	10: 11,166,557	I761M	probably benign	Het
Smg1	A	T	7: 118,160,204		probably benign	Het
Snupn	T	C	9: 56,957,061	S15P	probably damaging	Het
Tbc1d15	A	T	10: 115,208,969	Y509*	probably null	Het
Tcf4	T	C	18: 69,465,430	V72A	probably benign	Het
Tdrd3	T	C	14: 87,477,463		probably null	Het
Tm9sf4	T	A	2: 153,187,656	V175D	probably benign	Het
Vmn1r201	T	C	13: 22,474,922	L102P	probably damaging	Het
Wdfy4	T	A	14: 33,078,343	N1788I	possibly damaging	Het
Xpc	A	C	6: 91,493,010	V744G	probably damaging	Het
Xrcc6	T	C	15: 82,037,507	F178L	probably damaging	Het
Zfyve26	A	G	12: 79,270,850	V1196A	probably benign	Het

Other mutations in Rftn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Rftn1	APN	17	50055377	missense	probably benign	0.01
IGL02318:Rftn1	APN	17	50036970	missense	possibly damaging	0.95
IGL02568:Rftn1	APN	17	50036999	missense	probably damaging	1.00
IGL02873:Rftn1	APN	17	50169152	utr 5 prime	probably benign
IGL02965:Rftn1	APN	17	50055252	missense	probably benign	0.32
BB001:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB003:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB004:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB005:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB011:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB013:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB014:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB015:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R0544:Rftn1	UTSW	17	49994261	missense	possibly damaging	0.71
R2219:Rftn1	UTSW	17	50169145	start codon destroyed	probably null	1.00
R4542:Rftn1	UTSW	17	50055231	splice site	probably null
R5605:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R5700:Rftn1	UTSW	17	50002669	missense	probably damaging	1.00
R5853:Rftn1	UTSW	17	50047326	missense	probably damaging	1.00
R6459:Rftn1	UTSW	17	50047306	missense	probably benign	0.02
R6994:Rftn1	UTSW	17	50036991	missense	possibly damaging	0.82
R7210:Rftn1	UTSW	17	49994307	nonsense	probably null
R7283:Rftn1	UTSW	17	50047441	missense	probably damaging	1.00
R7348:Rftn1	UTSW	17	50004323	missense	probably damaging	1.00
R7444:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R7684:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7685:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7686:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7881:Rftn1	UTSW	17	50047435	missense	probably benign	0.08
R7924:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7926:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7927:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7928:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7943:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8052:Rftn1	UTSW	17	50086579	missense	probably damaging	0.98
R8162:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8164:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8248:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8249:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8250:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8271:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8272:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8273:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8296:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8297:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8300:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8315:Rftn1	UTSW	17	50002637	missense	possibly damaging	0.50
R8551:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8552:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8554:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8555:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8725:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8736:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8739:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
Z1176:Rftn1	UTSW	17	50169003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGGATTCGAGTGCCTAAG -3'
(R):5'- CACATGGAAGGTGTTAGCAGGC -3'

Sequencing Primer
(F):5'- GACCATTCTGCACAGCTGCTG -3'
(R):5'- CAGGCAGCAAGGGTGGG -3'

Posted On

2016-07-22