Mutagenetix > Incidental Mutation

Incidental Mutation 'R5319:Lama5'

405967

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

042902-MU

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 180181118 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 2785 (F2785S)

Ref Sequence

ENSEMBL: ENSMUSP00000015791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]

AlphaFold

no structure available at present

PDB Structure

LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015791
AA Change: F2785S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: F2785S

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000061437

SMART Domains

Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

Domain	Start	End	E-Value	Type
Pfam:Proteasom_Rpn13	29	111	3.5e-35	PFAM
low complexity region	135	161	N/A	INTRINSIC
low complexity region	173	254	N/A	INTRINSIC
Pfam:RPN13_C	268	381	7.3e-38	PFAM
low complexity region	390	403	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128029

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130796

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185089

Meta Mutation Damage Score

0.6741

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (69/73)

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	C	5: 146,504,696	S218P	probably benign	Het
A430078G23Rik	T	C	8: 3,385,010		probably null	Het
Ahctf1	A	C	1: 179,769,050	S121A	probably damaging	Het
Anpep	C	T	7: 79,841,731	R174H	probably benign	Het
Becn1	A	G	11: 101,288,803		probably benign	Het
Cabin1	T	C	10: 75,725,715	Y984C	probably damaging	Het
Cacna2d4	G	T	6: 119,347,252		probably null	Het
Ccdc14	T	G	16: 34,723,172	N633K	probably damaging	Het
Cdk5rap1	T	A	2: 154,335,569	T577S	possibly damaging	Het
Clca4b	T	C	3: 144,925,179	R307G	possibly damaging	Het
Colgalt2	A	G	1: 152,484,869	Q219R	possibly damaging	Het
Cops3	A	T	11: 59,827,936	D177E	possibly damaging	Het
Cyp2d9	T	C	15: 82,454,055	Y127H	probably damaging	Het
Dnajc11	A	G	4: 151,968,526	T98A	probably damaging	Het
Dst	T	C	1: 34,225,977	S4757P	possibly damaging	Het
Dvl2	C	T	11: 70,008,131	T448I	possibly damaging	Het
E230016K23Rik	T	G	11: 83,621,670		noncoding transcript	Het
Efl1	G	T	7: 82,674,506	D219Y	probably damaging	Het
Epha10	T	A	4: 124,914,000		probably benign	Het
Fbxw22	T	A	9: 109,383,947	T311S	possibly damaging	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Fshb	T	A	2: 107,058,879	I27F	probably damaging	Het
Gm340	G	A	19: 41,586,352	G1182D	probably damaging	Het
Gm8521	A	T	Y: 3,859,335		noncoding transcript	Het
Gpr45	T	C	1: 43,032,838	S214P	probably damaging	Het
Hgf	G	A	5: 16,566,862		probably null	Het
Hs6st1	T	C	1: 36,104,178	V398A	probably benign	Het
Ighmbp2	A	G	19: 3,271,646	V371A	probably damaging	Het
Kif18a	T	A	2: 109,318,025	N621K	probably benign	Het
Lrriq3	T	C	3: 155,129,471	I281T	possibly damaging	Het
Macf1	C	T	4: 123,473,436	A2511T	probably damaging	Het
Mark4	T	C	7: 19,436,961	D328G	possibly damaging	Het
Myo1c	G	A	11: 75,662,026	E434K	possibly damaging	Het
Nfe2l1	A	G	11: 96,819,379	S387P	probably damaging	Het
Nr1d2	A	G	14: 18,215,197	S272P	probably benign	Het
Nsrp1	T	C	11: 77,049,467	H104R	probably damaging	Het
Odf1	T	A	15: 38,219,619	S64T	probably benign	Het
Olfr1204	T	A	2: 88,852,778	I276K	probably damaging	Het
Olfr223	A	T	11: 59,589,651	V146E	probably damaging	Het
Olfr843	C	T	9: 19,249,033	R122H	possibly damaging	Het
Pde4b	C	A	4: 102,421,788		probably benign	Het
Phox2a	C	T	7: 101,820,850	T96M	probably damaging	Het
Plg	A	G	17: 12,403,227	E478G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppp1r12c	T	A	7: 4,483,984	T517S	probably benign	Het
Ptk7	C	T	17: 46,572,677	V821M	probably damaging	Het
Ptpn6	C	T	6: 124,732,950	V2M	probably benign	Het
Rgl2	T	C	17: 33,933,555	V380A	probably benign	Het
Rpl13a-ps1	A	G	19: 50,030,152	V195A	possibly damaging	Het
Rsph1	C	A	17: 31,273,377	V72F	probably benign	Het
Sh3bp4	T	C	1: 89,145,350	V640A	probably benign	Het
Simc1	T	A	13: 54,524,982	V381E	probably benign	Het
Slc15a3	A	T	19: 10,855,932	T438S	probably damaging	Het
Slc5a4b	C	T	10: 76,062,399	V494M	probably benign	Het
Sos2	C	A	12: 69,627,284	R335L	probably benign	Het
Trp53i13	A	T	11: 77,508,740	N254K	probably damaging	Het
Trpc6	A	G	9: 8,609,921	Y130C	probably damaging	Het
Trpv1	A	G	11: 73,239,589	I174V	probably damaging	Het
Tsnax	T	A	8: 125,015,719	D62E	probably damaging	Het
Vezt	T	A	10: 93,970,331	E739D	probably benign	Het
Vmn1r59	T	A	7: 5,454,210	I184F	probably damaging	Het
Yeats2	T	C	16: 20,186,425	V385A	probably benign	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
blancmange	UTSW	2	180180611	missense	probably damaging	0.98
cupcake	UTSW	2	180185959	missense	probably damaging	1.00
layercake	UTSW	2	180180718	missense	possibly damaging	0.83
poundcake	UTSW	2	180195608	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0003:Lama5	UTSW	2	180178079	splice site	probably null
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0148:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0326:Lama5	UTSW	2	180182426	missense	possibly damaging	0.90
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1078:Lama5	UTSW	2	180179764	unclassified	probably benign
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6406:Lama5	UTSW	2	180197464	nonsense	probably null
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7699:Lama5	UTSW	2	180180861	missense	probably damaging	1.00
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R8153:Lama5	UTSW	2	180187931	missense	probably benign	0.37
R8317:Lama5	UTSW	2	180206991	missense	probably damaging	1.00
R8351:Lama5	UTSW	2	180195608	missense	probably damaging	1.00
R8370:Lama5	UTSW	2	180201487	missense	possibly damaging	0.80
R8398:Lama5	UTSW	2	180197034	critical splice donor site	probably null
R8401:Lama5	UTSW	2	180198787	missense	probably damaging	1.00
R8404:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8502:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8694:Lama5	UTSW	2	180180884	missense	probably damaging	0.98
R8705:Lama5	UTSW	2	180178561	missense	probably damaging	1.00
R8732:Lama5	UTSW	2	180186688	missense	probably damaging	1.00
R8755:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R8786:Lama5	UTSW	2	180196307	missense	probably damaging	1.00
R8926:Lama5	UTSW	2	180193990	missense	probably benign	0.08
R8928:Lama5	UTSW	2	180202039	missense	probably damaging	1.00
R8953:Lama5	UTSW	2	180193520	missense	probably damaging	0.99
R8958:Lama5	UTSW	2	180193799	missense	probably benign
R9002:Lama5	UTSW	2	180196518	missense	probably damaging	1.00
R9081:Lama5	UTSW	2	180192137	nonsense	probably null
R9165:Lama5	UTSW	2	180179493	missense	probably damaging	0.99
R9233:Lama5	UTSW	2	180198709	nonsense	probably null
R9264:Lama5	UTSW	2	180196478	splice site	probably benign
R9311:Lama5	UTSW	2	180196482	critical splice donor site	probably null
R9443:Lama5	UTSW	2	180201729	missense	probably benign	0.00
R9488:Lama5	UTSW	2	180181441	missense	possibly damaging	0.95
R9674:Lama5	UTSW	2	180198474	critical splice donor site	probably null
R9684:Lama5	UTSW	2	180207245	missense	probably damaging	1.00
R9749:Lama5	UTSW	2	180183640	missense	probably benign	0.00
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACGCAGAGACACTCCCATGTAG -3'
(R):5'- TGCTCACCTTGGATGTAGGC -3'

Sequencing Primer
(F):5'- TCCCATGTAGTCCCCAGTGG -3'
(R):5'- GGTAGTAAACCCTCTCGTGC -3'

Posted On

2016-07-22