Incidental Mutation 'R5319:Lrriq3'
ID405969
Institutional Source Beutler Lab
Gene Symbol Lrriq3
Ensembl Gene ENSMUSG00000028182
Gene Nameleucine-rich repeats and IQ motif containing 3
Synonyms4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
MMRRC Submission 042902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5319 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location155093434-155194280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155129471 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 281 (I281T)
Ref Sequence ENSEMBL: ENSMUSP00000142127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000192383] [ENSMUST00000194376]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029833
AA Change: I281T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182
AA Change: I281T

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192383
AA Change: I281T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182
AA Change: I281T

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 9e-9 PFAM
Pfam:LRR_4 72 117 1.9e-8 PFAM
Pfam:LRR_1 73 94 5.1e-3 PFAM
IQ 214 236 3.68e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194376
AA Change: I281T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142127
Gene: ENSMUSG00000028182
AA Change: I281T

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 7.2e-9 PFAM
Pfam:LRR_4 72 117 1.5e-8 PFAM
Pfam:LRR_1 73 94 4.2e-3 PFAM
IQ 214 236 3.68e0 SMART
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,504,696 S218P probably benign Het
A430078G23Rik T C 8: 3,385,010 probably null Het
Ahctf1 A C 1: 179,769,050 S121A probably damaging Het
Anpep C T 7: 79,841,731 R174H probably benign Het
Becn1 A G 11: 101,288,803 probably benign Het
Cabin1 T C 10: 75,725,715 Y984C probably damaging Het
Cacna2d4 G T 6: 119,347,252 probably null Het
Ccdc14 T G 16: 34,723,172 N633K probably damaging Het
Cdk5rap1 T A 2: 154,335,569 T577S possibly damaging Het
Clca4b T C 3: 144,925,179 R307G possibly damaging Het
Colgalt2 A G 1: 152,484,869 Q219R possibly damaging Het
Cops3 A T 11: 59,827,936 D177E possibly damaging Het
Cyp2d9 T C 15: 82,454,055 Y127H probably damaging Het
Dnajc11 A G 4: 151,968,526 T98A probably damaging Het
Dst T C 1: 34,225,977 S4757P possibly damaging Het
Dvl2 C T 11: 70,008,131 T448I possibly damaging Het
E230016K23Rik T G 11: 83,621,670 noncoding transcript Het
Efl1 G T 7: 82,674,506 D219Y probably damaging Het
Epha10 T A 4: 124,914,000 probably benign Het
Fbxw22 T A 9: 109,383,947 T311S possibly damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Fshb T A 2: 107,058,879 I27F probably damaging Het
Gm340 G A 19: 41,586,352 G1182D probably damaging Het
Gm8521 A T Y: 3,859,335 noncoding transcript Het
Gpr45 T C 1: 43,032,838 S214P probably damaging Het
Hgf G A 5: 16,566,862 probably null Het
Hs6st1 T C 1: 36,104,178 V398A probably benign Het
Ighmbp2 A G 19: 3,271,646 V371A probably damaging Het
Kif18a T A 2: 109,318,025 N621K probably benign Het
Lama5 A G 2: 180,181,118 F2785S probably damaging Het
Macf1 C T 4: 123,473,436 A2511T probably damaging Het
Mark4 T C 7: 19,436,961 D328G possibly damaging Het
Myo1c G A 11: 75,662,026 E434K possibly damaging Het
Nfe2l1 A G 11: 96,819,379 S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 S272P probably benign Het
Nsrp1 T C 11: 77,049,467 H104R probably damaging Het
Odf1 T A 15: 38,219,619 S64T probably benign Het
Olfr1204 T A 2: 88,852,778 I276K probably damaging Het
Olfr223 A T 11: 59,589,651 V146E probably damaging Het
Olfr843 C T 9: 19,249,033 R122H possibly damaging Het
Pde4b C A 4: 102,421,788 probably benign Het
Phox2a C T 7: 101,820,850 T96M probably damaging Het
Plg A G 17: 12,403,227 E478G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r12c T A 7: 4,483,984 T517S probably benign Het
Ptk7 C T 17: 46,572,677 V821M probably damaging Het
Ptpn6 C T 6: 124,732,950 V2M probably benign Het
Rgl2 T C 17: 33,933,555 V380A probably benign Het
Rpl13a-ps1 A G 19: 50,030,152 V195A possibly damaging Het
Rsph1 C A 17: 31,273,377 V72F probably benign Het
Sh3bp4 T C 1: 89,145,350 V640A probably benign Het
Simc1 T A 13: 54,524,982 V381E probably benign Het
Slc15a3 A T 19: 10,855,932 T438S probably damaging Het
Slc5a4b C T 10: 76,062,399 V494M probably benign Het
Sos2 C A 12: 69,627,284 R335L probably benign Het
Trp53i13 A T 11: 77,508,740 N254K probably damaging Het
Trpc6 A G 9: 8,609,921 Y130C probably damaging Het
Trpv1 A G 11: 73,239,589 I174V probably damaging Het
Tsnax T A 8: 125,015,719 D62E probably damaging Het
Vezt T A 10: 93,970,331 E739D probably benign Het
Vmn1r59 T A 7: 5,454,210 I184F probably damaging Het
Yeats2 T C 16: 20,186,425 V385A probably benign Het
Other mutations in Lrriq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrriq3 APN 3 155101061 missense probably benign 0.29
IGL00468:Lrriq3 APN 3 155101179 missense probably damaging 1.00
IGL03272:Lrriq3 APN 3 155101058 missense probably damaging 0.99
PIT1430001:Lrriq3 UTSW 3 155098870 missense probably benign 0.36
R0526:Lrriq3 UTSW 3 155188297 missense probably benign 0.00
R0600:Lrriq3 UTSW 3 155187736 missense possibly damaging 0.51
R1420:Lrriq3 UTSW 3 155187712 missense probably benign
R2313:Lrriq3 UTSW 3 155164023 missense probably benign 0.00
R4024:Lrriq3 UTSW 3 155188302 missense probably benign 0.43
R4659:Lrriq3 UTSW 3 155129453 missense possibly damaging 0.47
R4801:Lrriq3 UTSW 3 155187970 missense probably benign
R4802:Lrriq3 UTSW 3 155187970 missense probably benign
R4864:Lrriq3 UTSW 3 155187810 missense possibly damaging 0.91
R4998:Lrriq3 UTSW 3 155188058 missense probably benign 0.13
R5120:Lrriq3 UTSW 3 155129384 missense probably benign 0.14
R5406:Lrriq3 UTSW 3 155129501 critical splice donor site probably null
R5943:Lrriq3 UTSW 3 155163950 missense probably damaging 0.99
R6184:Lrriq3 UTSW 3 155129402 missense probably benign 0.09
R6572:Lrriq3 UTSW 3 155181675 missense probably benign 0.01
R7389:Lrriq3 UTSW 3 155188104 missense probably benign 0.00
R7537:Lrriq3 UTSW 3 155101097 missense probably damaging 1.00
R7636:Lrriq3 UTSW 3 155188150 missense probably damaging 1.00
R7806:Lrriq3 UTSW 3 155098807 missense probably damaging 0.99
R8038:Lrriq3 UTSW 3 155164001 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTACACTGGACTCTCACTG -3'
(R):5'- GTGCTATTCTCTGATATCCACAGATTC -3'

Sequencing Primer
(F):5'- GGTACACTGGACTCTCACTGTGATAC -3'
(R):5'- CTGATATCCACAGATTCTAAAGCAGG -3'
Posted On2016-07-22