Incidental Mutation 'R5319:Dnajc11'
ID 405973
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene Name DnaJ heat shock protein family (Hsp40) member C11
Synonyms E030019A03Rik
MMRRC Submission 042902-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R5319 (G1)
Quality Score 206
Status Validated
Chromosome 4
Chromosomal Location 152018177-152066416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152052983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000122140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
AlphaFold Q5U458
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: T136A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: T136A

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138738
Predicted Effect probably damaging
Transcript: ENSMUST00000139069
AA Change: T136A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: T136A

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142198
Predicted Effect probably damaging
Transcript: ENSMUST00000147625
AA Change: T98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768
AA Change: T98A

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Meta Mutation Damage Score 0.2350 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,441,506 (GRCm39) S218P probably benign Het
Ahctf1 A C 1: 179,596,615 (GRCm39) S121A probably damaging Het
Anpep C T 7: 79,491,479 (GRCm39) R174H probably benign Het
Arhgef18 T C 8: 3,435,010 (GRCm39) probably null Het
Becn1 A G 11: 101,179,629 (GRCm39) probably benign Het
Cabin1 T C 10: 75,561,549 (GRCm39) Y984C probably damaging Het
Cacna2d4 G T 6: 119,324,213 (GRCm39) probably null Het
Ccdc14 T G 16: 34,543,542 (GRCm39) N633K probably damaging Het
Cdk5rap1 T A 2: 154,177,489 (GRCm39) T577S possibly damaging Het
Clca4b T C 3: 144,630,940 (GRCm39) R307G possibly damaging Het
Colgalt2 A G 1: 152,360,620 (GRCm39) Q219R possibly damaging Het
Cops3 A T 11: 59,718,762 (GRCm39) D177E possibly damaging Het
Cyp2d9 T C 15: 82,338,256 (GRCm39) Y127H probably damaging Het
Dst T C 1: 34,265,058 (GRCm39) S4757P possibly damaging Het
Dvl2 C T 11: 69,898,957 (GRCm39) T448I possibly damaging Het
E230016K23Rik T G 11: 83,512,496 (GRCm39) noncoding transcript Het
Efl1 G T 7: 82,323,714 (GRCm39) D219Y probably damaging Het
Epha10 T A 4: 124,807,793 (GRCm39) probably benign Het
Fbxw22 T A 9: 109,213,015 (GRCm39) T311S possibly damaging Het
Folr1 T A 7: 101,513,184 (GRCm39) D37V probably damaging Het
Fshb T A 2: 106,889,224 (GRCm39) I27F probably damaging Het
Gm8521 A T Y: 3,859,335 (GRCm39) noncoding transcript Het
Gpr45 T C 1: 43,071,998 (GRCm39) S214P probably damaging Het
Hgf G A 5: 16,771,860 (GRCm39) probably null Het
Hs6st1 T C 1: 36,143,259 (GRCm39) V398A probably benign Het
Ighmbp2 A G 19: 3,321,646 (GRCm39) V371A probably damaging Het
Kif18a T A 2: 109,148,370 (GRCm39) N621K probably benign Het
Lama5 A G 2: 179,822,911 (GRCm39) F2785S probably damaging Het
Lcor G A 19: 41,574,791 (GRCm39) G1182D probably damaging Het
Lrriq3 T C 3: 154,835,108 (GRCm39) I281T possibly damaging Het
Macf1 C T 4: 123,367,229 (GRCm39) A2511T probably damaging Het
Mark4 T C 7: 19,170,886 (GRCm39) D328G possibly damaging Het
Myo1c G A 11: 75,552,852 (GRCm39) E434K possibly damaging Het
Nfe2l1 A G 11: 96,710,205 (GRCm39) S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 (GRCm38) S272P probably benign Het
Nsrp1 T C 11: 76,940,293 (GRCm39) H104R probably damaging Het
Odf1 T A 15: 38,219,863 (GRCm39) S64T probably benign Het
Or2aa1 A T 11: 59,480,477 (GRCm39) V146E probably damaging Het
Or4c106 T A 2: 88,683,122 (GRCm39) I276K probably damaging Het
Or7g25 C T 9: 19,160,329 (GRCm39) R122H possibly damaging Het
Pde4b C A 4: 102,278,985 (GRCm39) probably benign Het
Phox2a C T 7: 101,470,057 (GRCm39) T96M probably damaging Het
Plg A G 17: 12,622,114 (GRCm39) E478G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ppp1r12c T A 7: 4,486,983 (GRCm39) T517S probably benign Het
Ptk7 C T 17: 46,883,603 (GRCm39) V821M probably damaging Het
Ptpn6 C T 6: 124,709,913 (GRCm39) V2M probably benign Het
Rgl2 T C 17: 34,152,529 (GRCm39) V380A probably benign Het
Rpl13a-ps1 A G 19: 50,018,591 (GRCm39) V195A possibly damaging Het
Rsph1 C A 17: 31,492,351 (GRCm39) V72F probably benign Het
Sh3bp4 T C 1: 89,073,072 (GRCm39) V640A probably benign Het
Simc1 T A 13: 54,672,795 (GRCm39) V381E probably benign Het
Slc15a3 A T 19: 10,833,296 (GRCm39) T438S probably damaging Het
Slc5a4b C T 10: 75,898,233 (GRCm39) V494M probably benign Het
Sos2 C A 12: 69,674,058 (GRCm39) R335L probably benign Het
Trp53i13 A T 11: 77,399,566 (GRCm39) N254K probably damaging Het
Trpc6 A G 9: 8,609,922 (GRCm39) Y130C probably damaging Het
Trpv1 A G 11: 73,130,415 (GRCm39) I174V probably damaging Het
Tsnax T A 8: 125,742,458 (GRCm39) D62E probably damaging Het
Vezt T A 10: 93,806,193 (GRCm39) E739D probably benign Het
Vmn1r59 T A 7: 5,457,209 (GRCm39) I184F probably damaging Het
Yeats2 T C 16: 20,005,175 (GRCm39) V385A probably benign Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 152,063,759 (GRCm39) missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 152,034,976 (GRCm39) nonsense probably null
IGL02606:Dnajc11 APN 4 152,063,941 (GRCm39) missense probably benign 0.18
IGL02969:Dnajc11 APN 4 152,062,503 (GRCm39) missense probably benign 0.33
IGL03062:Dnajc11 APN 4 152,055,318 (GRCm39) missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 152,037,346 (GRCm39) missense probably benign 0.04
R0601:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 152,058,085 (GRCm39) missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 152,063,730 (GRCm39) missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 152,062,550 (GRCm39) unclassified probably benign
R4545:Dnajc11 UTSW 4 152,064,398 (GRCm39) missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 152,058,074 (GRCm39) missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 152,052,996 (GRCm39) missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 152,055,424 (GRCm39) unclassified probably benign
R4751:Dnajc11 UTSW 4 152,052,999 (GRCm39) missense probably benign 0.01
R4895:Dnajc11 UTSW 4 152,064,390 (GRCm39) missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 152,061,454 (GRCm39) missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 152,054,271 (GRCm39) unclassified probably benign
R5174:Dnajc11 UTSW 4 152,064,441 (GRCm39) missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 152,054,396 (GRCm39) missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 152,063,967 (GRCm39) missense probably benign
R6056:Dnajc11 UTSW 4 152,062,583 (GRCm39) unclassified probably benign
R6434:Dnajc11 UTSW 4 152,063,751 (GRCm39) missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 152,053,068 (GRCm39) missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 152,058,682 (GRCm39) missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 152,034,909 (GRCm39) missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 152,053,045 (GRCm39) missense probably benign 0.00
R8093:Dnajc11 UTSW 4 152,054,357 (GRCm39) missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 152,055,368 (GRCm39) missense probably damaging 0.99
R8684:Dnajc11 UTSW 4 152,065,183 (GRCm39) makesense probably null
R9608:Dnajc11 UTSW 4 152,034,978 (GRCm39) missense possibly damaging 0.94
Z1176:Dnajc11 UTSW 4 152,018,240 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCGCAGTGTTTTATTTGACC -3'
(R):5'- TGCAGGCTTTCATAGAGATGAGG -3'

Sequencing Primer
(F):5'- ATTTGACCTGTGACATTGATGC -3'
(R):5'- GCTTTCATAGAGATGAGGCTCACC -3'
Posted On 2016-07-22