Mutagenetix > Incidental Mutation

Incidental Mutation 'R5319:Cacna2d4'

405977

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d4

Ensembl Gene

ENSMUSG00000041460

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 4

Synonyms

5730412N02Rik

MMRRC Submission

042902-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5319 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

119236526-119352407 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 119347252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]

AlphaFold

Q5RJF7

Predicted Effect

probably null
Transcript: ENSMUST00000037434

SMART Domains

Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	7.3e-40	PFAM
VWA	296	481	4.37e-14	SMART
Pfam:Cache_1	494	586	1.1e-24	PFAM
low complexity region	837	849	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1000	1011	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185965

Predicted Effect

probably null
Transcript: ENSMUST00000186622

SMART Domains

Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	6.4e-44	PFAM
VWA	296	481	2.7e-16	SMART
Pfam:Cache_1	494	559	1.1e-7	PFAM
low complexity region	812	824	N/A	INTRINSIC
low complexity region	950	959	N/A	INTRINSIC
low complexity region	975	986	N/A	INTRINSIC
low complexity region	1095	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186702

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	C	5: 146,504,696	S218P	probably benign	Het
A430078G23Rik	T	C	8: 3,385,010		probably null	Het
Ahctf1	A	C	1: 179,769,050	S121A	probably damaging	Het
Anpep	C	T	7: 79,841,731	R174H	probably benign	Het
Becn1	A	G	11: 101,288,803		probably benign	Het
Cabin1	T	C	10: 75,725,715	Y984C	probably damaging	Het
Ccdc14	T	G	16: 34,723,172	N633K	probably damaging	Het
Cdk5rap1	T	A	2: 154,335,569	T577S	possibly damaging	Het
Clca4b	T	C	3: 144,925,179	R307G	possibly damaging	Het
Colgalt2	A	G	1: 152,484,869	Q219R	possibly damaging	Het
Cops3	A	T	11: 59,827,936	D177E	possibly damaging	Het
Cyp2d9	T	C	15: 82,454,055	Y127H	probably damaging	Het
Dnajc11	A	G	4: 151,968,526	T98A	probably damaging	Het
Dst	T	C	1: 34,225,977	S4757P	possibly damaging	Het
Dvl2	C	T	11: 70,008,131	T448I	possibly damaging	Het
E230016K23Rik	T	G	11: 83,621,670		noncoding transcript	Het
Efl1	G	T	7: 82,674,506	D219Y	probably damaging	Het
Epha10	T	A	4: 124,914,000		probably benign	Het
Fbxw22	T	A	9: 109,383,947	T311S	possibly damaging	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Fshb	T	A	2: 107,058,879	I27F	probably damaging	Het
Gm340	G	A	19: 41,586,352	G1182D	probably damaging	Het
Gm8521	A	T	Y: 3,859,335		noncoding transcript	Het
Gpr45	T	C	1: 43,032,838	S214P	probably damaging	Het
Hgf	G	A	5: 16,566,862		probably null	Het
Hs6st1	T	C	1: 36,104,178	V398A	probably benign	Het
Ighmbp2	A	G	19: 3,271,646	V371A	probably damaging	Het
Kif18a	T	A	2: 109,318,025	N621K	probably benign	Het
Lama5	A	G	2: 180,181,118	F2785S	probably damaging	Het
Lrriq3	T	C	3: 155,129,471	I281T	possibly damaging	Het
Macf1	C	T	4: 123,473,436	A2511T	probably damaging	Het
Mark4	T	C	7: 19,436,961	D328G	possibly damaging	Het
Myo1c	G	A	11: 75,662,026	E434K	possibly damaging	Het
Nfe2l1	A	G	11: 96,819,379	S387P	probably damaging	Het
Nr1d2	A	G	14: 18,215,197	S272P	probably benign	Het
Nsrp1	T	C	11: 77,049,467	H104R	probably damaging	Het
Odf1	T	A	15: 38,219,619	S64T	probably benign	Het
Olfr1204	T	A	2: 88,852,778	I276K	probably damaging	Het
Olfr223	A	T	11: 59,589,651	V146E	probably damaging	Het
Olfr843	C	T	9: 19,249,033	R122H	possibly damaging	Het
Pde4b	C	A	4: 102,421,788		probably benign	Het
Phox2a	C	T	7: 101,820,850	T96M	probably damaging	Het
Plg	A	G	17: 12,403,227	E478G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppp1r12c	T	A	7: 4,483,984	T517S	probably benign	Het
Ptk7	C	T	17: 46,572,677	V821M	probably damaging	Het
Ptpn6	C	T	6: 124,732,950	V2M	probably benign	Het
Rgl2	T	C	17: 33,933,555	V380A	probably benign	Het
Rpl13a-ps1	A	G	19: 50,030,152	V195A	possibly damaging	Het
Rsph1	C	A	17: 31,273,377	V72F	probably benign	Het
Sh3bp4	T	C	1: 89,145,350	V640A	probably benign	Het
Simc1	T	A	13: 54,524,982	V381E	probably benign	Het
Slc15a3	A	T	19: 10,855,932	T438S	probably damaging	Het
Slc5a4b	C	T	10: 76,062,399	V494M	probably benign	Het
Sos2	C	A	12: 69,627,284	R335L	probably benign	Het
Trp53i13	A	T	11: 77,508,740	N254K	probably damaging	Het
Trpc6	A	G	9: 8,609,921	Y130C	probably damaging	Het
Trpv1	A	G	11: 73,239,589	I174V	probably damaging	Het
Tsnax	T	A	8: 125,015,719	D62E	probably damaging	Het
Vezt	T	A	10: 93,970,331	E739D	probably benign	Het
Vmn1r59	T	A	7: 5,454,210	I184F	probably damaging	Het
Yeats2	T	C	16: 20,186,425	V385A	probably benign	Het

Other mutations in Cacna2d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Cacna2d4	APN	6	119337933	splice site	probably benign
IGL00469:Cacna2d4	APN	6	119268278	missense	probably damaging	1.00
IGL00518:Cacna2d4	APN	6	119343575	missense	probably damaging	1.00
IGL00946:Cacna2d4	APN	6	119271915	missense	possibly damaging	0.82
IGL01447:Cacna2d4	APN	6	119242904	missense	probably damaging	1.00
IGL01514:Cacna2d4	APN	6	119282173	splice site	probably benign
IGL01576:Cacna2d4	APN	6	119281641	nonsense	probably null
IGL01934:Cacna2d4	APN	6	119308768	missense	probably damaging	1.00
IGL02231:Cacna2d4	APN	6	119277908	splice site	probably benign
IGL02516:Cacna2d4	APN	6	119271870	splice site	probably benign
IGL02688:Cacna2d4	APN	6	119270749	splice site	probably null
IGL03110:Cacna2d4	APN	6	119236737	missense	probably benign	0.05
IGL03365:Cacna2d4	APN	6	119271264	missense	probably benign	0.15
saccharine	UTSW	6	119345106	splice site	probably benign
Steveo	UTSW	6	119347252	critical splice donor site	probably null
Sussmann	UTSW	6	119274318	missense	probably damaging	1.00
R0139:Cacna2d4	UTSW	6	119278269	intron	probably benign
R0157:Cacna2d4	UTSW	6	119312424	missense	probably benign	0.00
R0158:Cacna2d4	UTSW	6	119236748	missense	possibly damaging	0.68
R0245:Cacna2d4	UTSW	6	119308721	missense	probably damaging	1.00
R0612:Cacna2d4	UTSW	6	119281718	splice site	probably benign
R0659:Cacna2d4	UTSW	6	119345106	splice site	probably benign
R0722:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0743:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0833:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0835:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0836:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0884:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1052:Cacna2d4	UTSW	6	119300333	missense	probably damaging	1.00
R1168:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1170:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1451:Cacna2d4	UTSW	6	119236824	missense	probably benign	0.01
R1564:Cacna2d4	UTSW	6	119241195	missense	possibly damaging	0.67
R1809:Cacna2d4	UTSW	6	119270824	missense	probably damaging	0.99
R1936:Cacna2d4	UTSW	6	119270761	missense	possibly damaging	0.82
R2078:Cacna2d4	UTSW	6	119338116	missense	probably benign	0.02
R2198:Cacna2d4	UTSW	6	119347259	splice site	probably benign
R2280:Cacna2d4	UTSW	6	119350041	missense	possibly damaging	0.85
R3757:Cacna2d4	UTSW	6	119241163	missense	probably damaging	0.98
R3975:Cacna2d4	UTSW	6	119278173	splice site	probably null
R3976:Cacna2d4	UTSW	6	119278173	splice site	probably null
R4238:Cacna2d4	UTSW	6	119240708	missense	probably null	1.00
R4591:Cacna2d4	UTSW	6	119298464	missense	probably benign	0.02
R4856:Cacna2d4	UTSW	6	119278256	missense	possibly damaging	0.90
R4899:Cacna2d4	UTSW	6	119268196	nonsense	probably null
R5351:Cacna2d4	UTSW	6	119268201	missense	probably damaging	1.00
R5366:Cacna2d4	UTSW	6	119274318	missense	probably damaging	1.00
R5393:Cacna2d4	UTSW	6	119239054	missense	probably benign	0.20
R5395:Cacna2d4	UTSW	6	119271418	missense	possibly damaging	0.71
R5408:Cacna2d4	UTSW	6	119348791	missense	probably damaging	1.00
R5603:Cacna2d4	UTSW	6	119244285	missense	probably damaging	1.00
R5661:Cacna2d4	UTSW	6	119343531	missense	probably benign
R5898:Cacna2d4	UTSW	6	119274231	missense	probably damaging	1.00
R5928:Cacna2d4	UTSW	6	119281698	missense	probably benign	0.06
R6186:Cacna2d4	UTSW	6	119281689	missense	possibly damaging	0.94
R6218:Cacna2d4	UTSW	6	119239060	missense	probably damaging	0.99
R6257:Cacna2d4	UTSW	6	119281619	critical splice acceptor site	probably null
R6409:Cacna2d4	UTSW	6	119282228	missense	probably damaging	0.99
R6931:Cacna2d4	UTSW	6	119282234	missense	possibly damaging	0.49
R7221:Cacna2d4	UTSW	6	119236663	missense	probably benign	0.02
R7363:Cacna2d4	UTSW	6	119343978	missense	probably damaging	1.00
R7371:Cacna2d4	UTSW	6	119308709	missense	probably benign	0.07
R7382:Cacna2d4	UTSW	6	119239087	missense	probably damaging	1.00
R7431:Cacna2d4	UTSW	6	119244276	missense	probably damaging	0.98
R7517:Cacna2d4	UTSW	6	119271921	missense	probably benign	0.01
R7527:Cacna2d4	UTSW	6	119271247	missense	probably benign	0.00
R7529:Cacna2d4	UTSW	6	119270766	missense	probably benign	0.01
R7710:Cacna2d4	UTSW	6	119274239	missense	probably benign	0.05
R7880:Cacna2d4	UTSW	6	119349155	missense	probably damaging	0.99
R8007:Cacna2d4	UTSW	6	119312444	missense	probably benign
R8084:Cacna2d4	UTSW	6	119300352	missense	probably damaging	1.00
R8159:Cacna2d4	UTSW	6	119297527	missense	probably benign	0.01
R8391:Cacna2d4	UTSW	6	119348745	missense	probably benign	0.04
R8700:Cacna2d4	UTSW	6	119281693	missense	probably damaging	1.00
R8857:Cacna2d4	UTSW	6	119271948	nonsense	probably null
R8973:Cacna2d4	UTSW	6	119241181	missense	probably damaging	1.00
R8976:Cacna2d4	UTSW	6	119338157	missense	possibly damaging	0.79
R8998:Cacna2d4	UTSW	6	119242915	missense	possibly damaging	0.90
R9129:Cacna2d4	UTSW	6	119336454	critical splice donor site	probably null
R9199:Cacna2d4	UTSW	6	119267826	missense	probably benign	0.12
R9228:Cacna2d4	UTSW	6	119271515	missense	probably benign	0.07
R9310:Cacna2d4	UTSW	6	119271953	critical splice donor site	probably null
R9315:Cacna2d4	UTSW	6	119236709	missense	probably benign
R9335:Cacna2d4	UTSW	6	119302053	missense	probably damaging	1.00
R9416:Cacna2d4	UTSW	6	119297518	missense	probably benign	0.06
R9514:Cacna2d4	UTSW	6	119236650	missense	probably benign
R9600:Cacna2d4	UTSW	6	119345062	missense	probably benign	0.02
RF023:Cacna2d4	UTSW	6	119268230	missense	probably benign	0.19
Z1176:Cacna2d4	UTSW	6	119312450	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GTTCCCTAAGGCCTTCTGTGATG -3'
(R):5'- TTGGCCCTGTGTCTCCTAAAG -3'

Sequencing Primer
(F):5'- GTGATGTGTGGTAACCCTCCTCAC -3'
(R):5'- CCTGTGTCTCCTAAAGCAGAC -3'

Posted On

2016-07-22