Mutagenetix > Incidental Mutation

Incidental Mutation 'R5319:Efl1'

405983

Institutional Source

Beutler Lab

Gene Symbol

Efl1

Ensembl Gene

ENSMUSG00000038563

Gene Name

elongation factor like GPTase 1

Synonyms

6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1

MMRRC Submission

042902-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.888) question?

Stock #

R5319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82648614-82777852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 82674506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 219 (D219Y)

Ref Sequence

ENSEMBL: ENSMUSP00000121909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000141726] [ENSMUST00000179489]

AlphaFold

Q8C0D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039881
AA Change: D219Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: D219Y

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	365	7.4e-62	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:EFG_II	614	687	4.3e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125245

Predicted Effect

probably damaging
Transcript: ENSMUST00000141726
AA Change: D219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: D219Y

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	222	2.3e-57	PFAM
Pfam:MMR_HSR1	21	147	2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153265

Predicted Effect

probably damaging
Transcript: ENSMUST00000179489
AA Change: D219Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: D219Y

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	364	8.7e-58	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:GTP_EFTU_D2	504	599	1e-7	PFAM
Pfam:EFG_II	614	687	1.8e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208798

Meta Mutation Damage Score

0.6087

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (69/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	C	5: 146,504,696	S218P	probably benign	Het
A430078G23Rik	T	C	8: 3,385,010		probably null	Het
Ahctf1	A	C	1: 179,769,050	S121A	probably damaging	Het
Anpep	C	T	7: 79,841,731	R174H	probably benign	Het
Becn1	A	G	11: 101,288,803		probably benign	Het
Cabin1	T	C	10: 75,725,715	Y984C	probably damaging	Het
Cacna2d4	G	T	6: 119,347,252		probably null	Het
Ccdc14	T	G	16: 34,723,172	N633K	probably damaging	Het
Cdk5rap1	T	A	2: 154,335,569	T577S	possibly damaging	Het
Clca4b	T	C	3: 144,925,179	R307G	possibly damaging	Het
Colgalt2	A	G	1: 152,484,869	Q219R	possibly damaging	Het
Cops3	A	T	11: 59,827,936	D177E	possibly damaging	Het
Cyp2d9	T	C	15: 82,454,055	Y127H	probably damaging	Het
Dnajc11	A	G	4: 151,968,526	T98A	probably damaging	Het
Dst	T	C	1: 34,225,977	S4757P	possibly damaging	Het
Dvl2	C	T	11: 70,008,131	T448I	possibly damaging	Het
E230016K23Rik	T	G	11: 83,621,670		noncoding transcript	Het
Epha10	T	A	4: 124,914,000		probably benign	Het
Fbxw22	T	A	9: 109,383,947	T311S	possibly damaging	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Fshb	T	A	2: 107,058,879	I27F	probably damaging	Het
Gm340	G	A	19: 41,586,352	G1182D	probably damaging	Het
Gm8521	A	T	Y: 3,859,335		noncoding transcript	Het
Gpr45	T	C	1: 43,032,838	S214P	probably damaging	Het
Hgf	G	A	5: 16,566,862		probably null	Het
Hs6st1	T	C	1: 36,104,178	V398A	probably benign	Het
Ighmbp2	A	G	19: 3,271,646	V371A	probably damaging	Het
Kif18a	T	A	2: 109,318,025	N621K	probably benign	Het
Lama5	A	G	2: 180,181,118	F2785S	probably damaging	Het
Lrriq3	T	C	3: 155,129,471	I281T	possibly damaging	Het
Macf1	C	T	4: 123,473,436	A2511T	probably damaging	Het
Mark4	T	C	7: 19,436,961	D328G	possibly damaging	Het
Myo1c	G	A	11: 75,662,026	E434K	possibly damaging	Het
Nfe2l1	A	G	11: 96,819,379	S387P	probably damaging	Het
Nr1d2	A	G	14: 18,215,197	S272P	probably benign	Het
Nsrp1	T	C	11: 77,049,467	H104R	probably damaging	Het
Odf1	T	A	15: 38,219,619	S64T	probably benign	Het
Olfr1204	T	A	2: 88,852,778	I276K	probably damaging	Het
Olfr223	A	T	11: 59,589,651	V146E	probably damaging	Het
Olfr843	C	T	9: 19,249,033	R122H	possibly damaging	Het
Pde4b	C	A	4: 102,421,788		probably benign	Het
Phox2a	C	T	7: 101,820,850	T96M	probably damaging	Het
Plg	A	G	17: 12,403,227	E478G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppp1r12c	T	A	7: 4,483,984	T517S	probably benign	Het
Ptk7	C	T	17: 46,572,677	V821M	probably damaging	Het
Ptpn6	C	T	6: 124,732,950	V2M	probably benign	Het
Rgl2	T	C	17: 33,933,555	V380A	probably benign	Het
Rpl13a-ps1	A	G	19: 50,030,152	V195A	possibly damaging	Het
Rsph1	C	A	17: 31,273,377	V72F	probably benign	Het
Sh3bp4	T	C	1: 89,145,350	V640A	probably benign	Het
Simc1	T	A	13: 54,524,982	V381E	probably benign	Het
Slc15a3	A	T	19: 10,855,932	T438S	probably damaging	Het
Slc5a4b	C	T	10: 76,062,399	V494M	probably benign	Het
Sos2	C	A	12: 69,627,284	R335L	probably benign	Het
Trp53i13	A	T	11: 77,508,740	N254K	probably damaging	Het
Trpc6	A	G	9: 8,609,921	Y130C	probably damaging	Het
Trpv1	A	G	11: 73,239,589	I174V	probably damaging	Het
Tsnax	T	A	8: 125,015,719	D62E	probably damaging	Het
Vezt	T	A	10: 93,970,331	E739D	probably benign	Het
Vmn1r59	T	A	7: 5,454,210	I184F	probably damaging	Het
Yeats2	T	C	16: 20,186,425	V385A	probably benign	Het

Other mutations in Efl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00541:Efl1	APN	7	82658111	missense	probably damaging	1.00
IGL00696:Efl1	APN	7	82651872	splice site	probably benign
IGL01344:Efl1	APN	7	82681480	splice site	probably benign
IGL01871:Efl1	APN	7	82763319	missense	possibly damaging	0.64
IGL01941:Efl1	APN	7	82697976	missense	probably benign	0.17
IGL02104:Efl1	APN	7	82658055	critical splice acceptor site	probably null
IGL02150:Efl1	APN	7	82686691	missense	probably benign
IGL02484:Efl1	APN	7	82683039	missense	probably damaging	0.98
IGL03140:Efl1	APN	7	82692881	missense	probably benign	0.00
IGL03188:Efl1	APN	7	82671701	missense	probably damaging	1.00
IGL03014:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
PIT4469001:Efl1	UTSW	7	82658165	missense	probably benign	0.14
R0148:Efl1	UTSW	7	82671670	missense	probably damaging	1.00
R0226:Efl1	UTSW	7	82693011	splice site	probably benign
R0638:Efl1	UTSW	7	82651887	missense	probably damaging	1.00
R0684:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
R1018:Efl1	UTSW	7	82763013	missense	possibly damaging	0.94
R1290:Efl1	UTSW	7	82671728	missense	probably damaging	1.00
R1720:Efl1	UTSW	7	82683721	missense	possibly damaging	0.50
R1933:Efl1	UTSW	7	82763117	nonsense	probably null
R1973:Efl1	UTSW	7	82762877	missense	probably damaging	1.00
R2016:Efl1	UTSW	7	82753709	missense	probably damaging	1.00
R2124:Efl1	UTSW	7	82692913	missense	probably damaging	1.00
R2290:Efl1	UTSW	7	82777670	missense	probably damaging	1.00
R2415:Efl1	UTSW	7	82697967	missense	probably damaging	1.00
R3545:Efl1	UTSW	7	82762810	missense	probably benign	0.00
R3688:Efl1	UTSW	7	82762970	missense	probably benign	0.00
R4092:Efl1	UTSW	7	82762827	missense	probably benign	0.00
R4207:Efl1	UTSW	7	82750816	missense	probably damaging	0.98
R4347:Efl1	UTSW	7	82697966	missense	probably damaging	1.00
R4425:Efl1	UTSW	7	82763283	missense	probably damaging	0.99
R4816:Efl1	UTSW	7	82671719	missense	probably damaging	1.00
R4858:Efl1	UTSW	7	82671627	missense	probably damaging	1.00
R5077:Efl1	UTSW	7	82658087	missense	probably damaging	1.00
R5185:Efl1	UTSW	7	82772499	missense	probably damaging	1.00
R5771:Efl1	UTSW	7	82692524	missense	probably benign	0.26
R5857:Efl1	UTSW	7	82763189	missense	probably benign
R5956:Efl1	UTSW	7	82651899	missense	probably damaging	1.00
R6433:Efl1	UTSW	7	82674568	missense	probably damaging	1.00
R7131:Efl1	UTSW	7	82658064	missense	probably damaging	1.00
R7143:Efl1	UTSW	7	82762680	missense	probably damaging	1.00
R7312:Efl1	UTSW	7	82681444	missense	probably benign	0.10
R7409:Efl1	UTSW	7	82697913	missense	probably damaging	0.98
R7422:Efl1	UTSW	7	82681379	missense	probably damaging	1.00
R7453:Efl1	UTSW	7	82681467	missense	possibly damaging	0.76
R7504:Efl1	UTSW	7	82683049	missense	probably damaging	1.00
R7884:Efl1	UTSW	7	82658099	missense	probably damaging	1.00
R7969:Efl1	UTSW	7	82692970	missense	probably benign	0.03
R8394:Efl1	UTSW	7	82762778	missense	probably benign	0.00
R8702:Efl1	UTSW	7	82750790	critical splice acceptor site	probably null
R8924:Efl1	UTSW	7	82762953	missense	probably benign	0.03
R9463:Efl1	UTSW	7	82777525	missense	probably damaging	1.00
R9762:Efl1	UTSW	7	82763388	missense	probably benign	0.09
Z1088:Efl1	UTSW	7	82692850	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAGACAGTGTGCTCCCTCC -3'
(R):5'- TGGCAGGACACAAGATAACTATATC -3'

Sequencing Primer
(F):5'- GTGTCCTAGCATATGAATGACGC -3'
(R):5'- AGAAGCAGAGGACTTACC -3'

Posted On

2016-07-22