Mutagenetix > Incidental Mutations

Incidental Mutation 'R0498:Stard13'

40599

Institutional Source

Beutler Lab

Gene Symbol

Stard13

Ensembl Gene

ENSMUSG00000016128

Gene Name

StAR-related lipid transfer (START) domain containing 13

Synonyms

GT650, DLC2

MMRRC Submission

038694-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151037510-151233836 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 151052477 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 742 (Y742F)

Ref Sequence

ENSEMBL: ENSMUSP00000053232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000202111]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062015
AA Change: Y742F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: Y742F

Domain	Start	End	E-Value	Type
Pfam:SAM_2	59	120	2.6e-6	PFAM
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	693	884	2.37e-50	SMART
START	927	1129	2.08e-40	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110483
AA Change: Y723F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: Y723F

Domain	Start	End	E-Value	Type
PDB:2JW2\|A	50	120	1e-37	PDB
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	674	865	2.37e-50	SMART
START	908	1110	2.08e-40	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202111
AA Change: Y605F

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: Y605F

Domain	Start	End	E-Value	Type
low complexity region	79	98	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
RhoGAP	556	747	1.4e-52	SMART
START	790	992	1.4e-42	SMART

Meta Mutation Damage Score

0.3050

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,294	D220V	probably benign	Het
4933406M09Rik	A	G	1: 134,390,872	I461V	possibly damaging	Het
6720489N17Rik	T	C	13: 62,607,387	N39S	probably damaging	Het
Adgrf2	A	G	17: 42,714,315		probably benign	Het
Aldh18a1	A	G	19: 40,574,272	V219A	probably benign	Het
Anapc10	A	G	8: 79,774,981	D126G	probably benign	Het
Ap1m2	T	C	9: 21,295,833	*426W	probably null	Het
Arhgap21	A	G	2: 20,863,117	I865T	probably damaging	Het
Armc8	A	G	9: 99,497,292	V527A	probably damaging	Het
Asic5	A	T	3: 82,006,471		probably benign	Het
Baz2b	A	C	2: 59,901,996		probably benign	Het
Bpifa5	T	C	2: 154,167,249	V237A	probably damaging	Het
Brip1	T	A	11: 86,197,919	K52I	possibly damaging	Het
Cacna1g	T	C	11: 94,459,859	I387V	probably damaging	Het
Cbr4	A	G	8: 61,495,073	I135V	probably benign	Het
Ccdc66	C	T	14: 27,500,240		probably null	Het
Cubn	G	A	2: 13,444,267	T999M	probably damaging	Het
Dpp8	C	T	9: 65,045,795		probably benign	Het
Dsg1b	T	C	18: 20,409,333	S966P	possibly damaging	Het
Erp27	T	C	6: 136,919,864		probably benign	Het
Fat4	A	T	3: 38,980,637	I2813L	probably benign	Het
Fhod1	G	A	8: 105,329,856	R1101C	probably damaging	Het
Hoxc9	T	C	15: 102,983,927	S191P	probably damaging	Het
Izumo4	T	C	10: 80,704,196		probably null	Het
Kalrn	C	T	16: 34,054,891	D104N	possibly damaging	Het
Kank4	A	T	4: 98,779,636	D191E	probably benign	Het
Kbtbd11	A	G	8: 15,027,605	E68G	probably benign	Het
Kdr	C	T	5: 75,959,138	V654I	probably benign	Het
Klra1	A	T	6: 130,372,819		probably null	Het
Kmt2e	T	A	5: 23,478,972	Y373*	probably null	Het
Lepr	A	T	4: 101,745,692	M226L	probably benign	Het
Lrp1b	T	A	2: 41,458,405	I800F	probably benign	Het
Lta4h	T	C	10: 93,471,971		probably benign	Het
Map3k7	T	C	4: 31,974,814		probably benign	Het
Map4k4	G	A	1: 39,990,178	R371Q	probably benign	Het
Mme	A	G	3: 63,346,066	I444V	probably damaging	Het
Mms19	C	T	19: 41,949,773	R582Q	possibly damaging	Het
Mtss1	A	G	15: 58,945,437	S502P	probably damaging	Het
Myo3a	G	T	2: 22,577,429	A232S	possibly damaging	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr727	A	C	14: 50,127,293	T239P	probably damaging	Het
Olfr874	G	A	9: 37,746,254	G40E	probably damaging	Het
Pcm1	G	A	8: 41,293,769	S1335N	probably benign	Het
Pdzph1	A	G	17: 58,973,830	F486L	probably benign	Het
Piezo2	T	C	18: 63,102,174	K552R	possibly damaging	Het
Plekhs1	T	A	19: 56,481,104		probably null	Het
Pprc1	C	T	19: 46,071,568	Q1514*	probably null	Het
Ralgapa1	T	C	12: 55,689,791	T1831A	possibly damaging	Het
Rnpep	G	T	1: 135,265,352	D455E	probably damaging	Het
Rpgrip1	T	A	14: 52,131,314		probably benign	Het
Saxo1	A	T	4: 86,478,896	M135K	possibly damaging	Het
Serpina12	T	C	12: 104,035,789	T223A	probably damaging	Het
Serpinb3a	A	G	1: 107,047,150	F218L	probably damaging	Het
Serpinb9f	T	G	13: 33,326,007		probably benign	Het
Spata33	A	G	8: 123,221,923	D98G	probably benign	Het
Tcrg-C3	T	A	13: 19,261,092	M70K	probably damaging	Het
Tecta	A	G	9: 42,377,614	Y552H	probably damaging	Het
Tie1	A	T	4: 118,479,161		probably benign	Het
Tmem161a	A	G	8: 70,180,973	T254A	probably benign	Het
Tmem30a	G	T	9: 79,774,094	Y264*	probably null	Het
Tmem87a	A	T	2: 120,394,465	I105K	probably benign	Het
Tnrc6b	A	T	15: 80,858,719	D51V	probably damaging	Het
Trpc4	T	C	3: 54,291,211	F519L	probably damaging	Het
Ttn	T	C	2: 76,709,581	T26027A	probably damaging	Het
Vmn1r198	A	C	13: 22,354,974	H121P	probably damaging	Het
Vps33a	A	G	5: 123,570,961	F64L	probably benign	Het
Wdr63	G	T	3: 146,081,364	D305E	possibly damaging	Het
Zfp994	A	T	17: 22,200,901	C356S	probably damaging	Het

Other mutations in Stard13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Stard13	APN	5	151042239	missense	probably damaging	1.00
IGL01362:Stard13	APN	5	151189952	missense	probably benign	0.05
IGL01588:Stard13	APN	5	151045237	missense	probably damaging	1.00
IGL01947:Stard13	APN	5	151062844	missense	probably damaging	1.00
IGL02294:Stard13	APN	5	151063115	missense	probably benign	0.19
IGL02713:Stard13	APN	5	151042186	nonsense	probably null
IGL02746:Stard13	APN	5	151046857	splice site	probably benign
IGL02827:Stard13	APN	5	151063126	missense	probably benign	0.07
R1427:Stard13	UTSW	5	151045991	missense	probably damaging	0.99
R1785:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R1857:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R1858:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R2130:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2131:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2132:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2133:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2258:Stard13	UTSW	5	151039731	missense	probably damaging	1.00
R3435:Stard13	UTSW	5	151042179	missense	probably damaging	1.00
R4080:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4081:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4082:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4233:Stard13	UTSW	5	151062699	missense	probably benign	0.00
R4288:Stard13	UTSW	5	151045177	missense	probably damaging	1.00
R4303:Stard13	UTSW	5	151062869	missense	possibly damaging	0.82
R4659:Stard13	UTSW	5	151062788	missense	probably benign	0.01
R4695:Stard13	UTSW	5	151060815	missense	probably benign	0.08
R4910:Stard13	UTSW	5	151062527	missense	probably benign
R5135:Stard13	UTSW	5	151062767	nonsense	probably null
R5338:Stard13	UTSW	5	151059598	missense	probably damaging	1.00
R5399:Stard13	UTSW	5	151047801	nonsense	probably null
R5546:Stard13	UTSW	5	151045901	missense	probably benign	0.03
R5685:Stard13	UTSW	5	151063127	missense	possibly damaging	0.78
R5771:Stard13	UTSW	5	151190011	missense	probably damaging	1.00
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6141:Stard13	UTSW	5	151042242	missense	probably damaging	1.00
R6171:Stard13	UTSW	5	151092762	missense	probably damaging	1.00
R6296:Stard13	UTSW	5	151062673	missense	probably damaging	1.00
R6326:Stard13	UTSW	5	151046919	missense	possibly damaging	0.95
R6508:Stard13	UTSW	5	151063289	missense	probably benign	0.06
R7252:Stard13	UTSW	5	151063169	missense	probably benign	0.01
R7318:Stard13	UTSW	5	151062573	nonsense	probably null
R7459:Stard13	UTSW	5	151047599	missense	probably damaging	1.00
R7571:Stard13	UTSW	5	151059502	missense	probably damaging	0.97
R7696:Stard13	UTSW	5	151060802	missense	probably damaging	0.99
R7809:Stard13	UTSW	5	151190024	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGACACAGAGATGTCCATAGCAAACTG -3'
(R):5'- TTGAGCTAGGATAGACTCCCAGCTCC -3'

Sequencing Primer
(F):5'- tcacagaggagcatagttcag -3'
(R):5'- AGCTCCCCAAGTCCTGG -3'

Posted On

2013-05-23