Incidental Mutation 'R5319:Olfr843'
ID405990
Institutional Source Beutler Lab
Gene Symbol Olfr843
Ensembl Gene ENSMUSG00000048391
Gene Nameolfactory receptor 843
SynonymsGA_x6K02T2PVTD-12986331-12985390, MOR155-2
MMRRC Submission 042902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5319 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19242956-19251987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19249033 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000151203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061365] [ENSMUST00000214019] [ENSMUST00000214267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061365
AA Change: R122H

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051027
Gene: ENSMUSG00000048391
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-51 PFAM
Pfam:7tm_1 41 290 3.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214019
AA Change: R122H

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214267
AA Change: R122H

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,504,696 S218P probably benign Het
A430078G23Rik T C 8: 3,385,010 probably null Het
Ahctf1 A C 1: 179,769,050 S121A probably damaging Het
Anpep C T 7: 79,841,731 R174H probably benign Het
Becn1 A G 11: 101,288,803 probably benign Het
Cabin1 T C 10: 75,725,715 Y984C probably damaging Het
Cacna2d4 G T 6: 119,347,252 probably null Het
Ccdc14 T G 16: 34,723,172 N633K probably damaging Het
Cdk5rap1 T A 2: 154,335,569 T577S possibly damaging Het
Clca4b T C 3: 144,925,179 R307G possibly damaging Het
Colgalt2 A G 1: 152,484,869 Q219R possibly damaging Het
Cops3 A T 11: 59,827,936 D177E possibly damaging Het
Cyp2d9 T C 15: 82,454,055 Y127H probably damaging Het
Dnajc11 A G 4: 151,968,526 T98A probably damaging Het
Dst T C 1: 34,225,977 S4757P possibly damaging Het
Dvl2 C T 11: 70,008,131 T448I possibly damaging Het
E230016K23Rik T G 11: 83,621,670 noncoding transcript Het
Efl1 G T 7: 82,674,506 D219Y probably damaging Het
Epha10 T A 4: 124,914,000 probably benign Het
Fbxw22 T A 9: 109,383,947 T311S possibly damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Fshb T A 2: 107,058,879 I27F probably damaging Het
Gm340 G A 19: 41,586,352 G1182D probably damaging Het
Gm8521 A T Y: 3,859,335 noncoding transcript Het
Gpr45 T C 1: 43,032,838 S214P probably damaging Het
Hgf G A 5: 16,566,862 probably null Het
Hs6st1 T C 1: 36,104,178 V398A probably benign Het
Ighmbp2 A G 19: 3,271,646 V371A probably damaging Het
Kif18a T A 2: 109,318,025 N621K probably benign Het
Lama5 A G 2: 180,181,118 F2785S probably damaging Het
Lrriq3 T C 3: 155,129,471 I281T possibly damaging Het
Macf1 C T 4: 123,473,436 A2511T probably damaging Het
Mark4 T C 7: 19,436,961 D328G possibly damaging Het
Myo1c G A 11: 75,662,026 E434K possibly damaging Het
Nfe2l1 A G 11: 96,819,379 S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 S272P probably benign Het
Nsrp1 T C 11: 77,049,467 H104R probably damaging Het
Odf1 T A 15: 38,219,619 S64T probably benign Het
Olfr1204 T A 2: 88,852,778 I276K probably damaging Het
Olfr223 A T 11: 59,589,651 V146E probably damaging Het
Pde4b C A 4: 102,421,788 probably benign Het
Phox2a C T 7: 101,820,850 T96M probably damaging Het
Plg A G 17: 12,403,227 E478G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r12c T A 7: 4,483,984 T517S probably benign Het
Ptk7 C T 17: 46,572,677 V821M probably damaging Het
Ptpn6 C T 6: 124,732,950 V2M probably benign Het
Rgl2 T C 17: 33,933,555 V380A probably benign Het
Rpl13a-ps1 A G 19: 50,030,152 V195A possibly damaging Het
Rsph1 C A 17: 31,273,377 V72F probably benign Het
Sh3bp4 T C 1: 89,145,350 V640A probably benign Het
Simc1 T A 13: 54,524,982 V381E probably benign Het
Slc15a3 A T 19: 10,855,932 T438S probably damaging Het
Slc5a4b C T 10: 76,062,399 V494M probably benign Het
Sos2 C A 12: 69,627,284 R335L probably benign Het
Trp53i13 A T 11: 77,508,740 N254K probably damaging Het
Trpc6 A G 9: 8,609,921 Y130C probably damaging Het
Trpv1 A G 11: 73,239,589 I174V probably damaging Het
Tsnax T A 8: 125,015,719 D62E probably damaging Het
Vezt T A 10: 93,970,331 E739D probably benign Het
Vmn1r59 T A 7: 5,454,210 I184F probably damaging Het
Yeats2 T C 16: 20,186,425 V385A probably benign Het
Other mutations in Olfr843
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr843 APN 9 19248870 missense probably benign 0.21
IGL02338:Olfr843 APN 9 19248664 missense probably damaging 0.98
IGL03197:Olfr843 APN 9 19248802 missense probably benign 0.37
IGL03227:Olfr843 APN 9 19249222 missense probably damaging 1.00
IGL03046:Olfr843 UTSW 9 19249145 missense probably damaging 0.99
IGL03052:Olfr843 UTSW 9 19248642 nonsense probably null
R0423:Olfr843 UTSW 9 19248952 nonsense probably null
R1316:Olfr843 UTSW 9 19248739 missense probably benign 0.06
R1759:Olfr843 UTSW 9 19249088 missense probably benign 0.36
R1782:Olfr843 UTSW 9 19248581 missense probably benign 0.04
R2517:Olfr843 UTSW 9 19249061 missense probably benign 0.21
R3196:Olfr843 UTSW 9 19249199 missense probably damaging 1.00
R3742:Olfr843 UTSW 9 19248683 missense possibly damaging 0.91
R4191:Olfr843 UTSW 9 19249087 missense probably benign 0.05
R4320:Olfr843 UTSW 9 19248756 missense probably damaging 1.00
R4523:Olfr843 UTSW 9 19249229 missense probably damaging 0.98
R4756:Olfr843 UTSW 9 19248857 missense possibly damaging 0.56
R4908:Olfr843 UTSW 9 19248853 missense probably benign 0.00
R5554:Olfr843 UTSW 9 19248743 missense probably benign 0.02
R6011:Olfr843 UTSW 9 19248511 missense probably damaging 0.98
R7330:Olfr843 UTSW 9 19249271 missense probably benign 0.01
R7862:Olfr843 UTSW 9 19249440 start gained probably benign
R7945:Olfr843 UTSW 9 19249440 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGCAGGCATGTTTGATG -3'
(R):5'- TGGATTATCACCTCCATACACC -3'

Sequencing Primer
(F):5'- GGCATGTTTGATGACTTGAACAAG -3'
(R):5'- TTATCACCTCCATACACCCATGTAC -3'
Posted On2016-07-22