Incidental Mutation 'R5319:Nfe2l1'
ID 406004
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Name nuclear factor, erythroid derived 2,-like 1
Synonyms TCF-11, LCR-F1, TCF11, NRF1, Lcrf1
MMRRC Submission 042902-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5319 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 96708240-96720794 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96710205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 387 (S387P)
Ref Sequence ENSEMBL: ENSMUSP00000131585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000167149] [ENSMUST00000169828] [ENSMUST00000167110] [ENSMUST00000142065]
AlphaFold Q61985
Predicted Effect probably damaging
Transcript: ENSMUST00000081775
AA Change: S675P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: S675P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107657
AA Change: S675P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: S675P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107658
AA Change: S675P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: S675P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107659
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134951
Predicted Effect probably damaging
Transcript: ENSMUST00000167149
AA Change: S675P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: S675P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169828
AA Change: S387P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615
AA Change: S387P

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167110
AA Change: S517P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615
AA Change: S517P

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140138
Predicted Effect probably benign
Transcript: ENSMUST00000142065
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Meta Mutation Damage Score 0.2447 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,441,506 (GRCm39) S218P probably benign Het
Ahctf1 A C 1: 179,596,615 (GRCm39) S121A probably damaging Het
Anpep C T 7: 79,491,479 (GRCm39) R174H probably benign Het
Arhgef18 T C 8: 3,435,010 (GRCm39) probably null Het
Becn1 A G 11: 101,179,629 (GRCm39) probably benign Het
Cabin1 T C 10: 75,561,549 (GRCm39) Y984C probably damaging Het
Cacna2d4 G T 6: 119,324,213 (GRCm39) probably null Het
Ccdc14 T G 16: 34,543,542 (GRCm39) N633K probably damaging Het
Cdk5rap1 T A 2: 154,177,489 (GRCm39) T577S possibly damaging Het
Clca4b T C 3: 144,630,940 (GRCm39) R307G possibly damaging Het
Colgalt2 A G 1: 152,360,620 (GRCm39) Q219R possibly damaging Het
Cops3 A T 11: 59,718,762 (GRCm39) D177E possibly damaging Het
Cyp2d9 T C 15: 82,338,256 (GRCm39) Y127H probably damaging Het
Dnajc11 A G 4: 152,052,983 (GRCm39) T98A probably damaging Het
Dst T C 1: 34,265,058 (GRCm39) S4757P possibly damaging Het
Dvl2 C T 11: 69,898,957 (GRCm39) T448I possibly damaging Het
E230016K23Rik T G 11: 83,512,496 (GRCm39) noncoding transcript Het
Efl1 G T 7: 82,323,714 (GRCm39) D219Y probably damaging Het
Epha10 T A 4: 124,807,793 (GRCm39) probably benign Het
Fbxw22 T A 9: 109,213,015 (GRCm39) T311S possibly damaging Het
Folr1 T A 7: 101,513,184 (GRCm39) D37V probably damaging Het
Fshb T A 2: 106,889,224 (GRCm39) I27F probably damaging Het
Gm8521 A T Y: 3,859,335 (GRCm39) noncoding transcript Het
Gpr45 T C 1: 43,071,998 (GRCm39) S214P probably damaging Het
Hgf G A 5: 16,771,860 (GRCm39) probably null Het
Hs6st1 T C 1: 36,143,259 (GRCm39) V398A probably benign Het
Ighmbp2 A G 19: 3,321,646 (GRCm39) V371A probably damaging Het
Kif18a T A 2: 109,148,370 (GRCm39) N621K probably benign Het
Lama5 A G 2: 179,822,911 (GRCm39) F2785S probably damaging Het
Lcor G A 19: 41,574,791 (GRCm39) G1182D probably damaging Het
Lrriq3 T C 3: 154,835,108 (GRCm39) I281T possibly damaging Het
Macf1 C T 4: 123,367,229 (GRCm39) A2511T probably damaging Het
Mark4 T C 7: 19,170,886 (GRCm39) D328G possibly damaging Het
Myo1c G A 11: 75,552,852 (GRCm39) E434K possibly damaging Het
Nr1d2 A G 14: 18,215,197 (GRCm38) S272P probably benign Het
Nsrp1 T C 11: 76,940,293 (GRCm39) H104R probably damaging Het
Odf1 T A 15: 38,219,863 (GRCm39) S64T probably benign Het
Or2aa1 A T 11: 59,480,477 (GRCm39) V146E probably damaging Het
Or4c106 T A 2: 88,683,122 (GRCm39) I276K probably damaging Het
Or7g25 C T 9: 19,160,329 (GRCm39) R122H possibly damaging Het
Pde4b C A 4: 102,278,985 (GRCm39) probably benign Het
Phox2a C T 7: 101,470,057 (GRCm39) T96M probably damaging Het
Plg A G 17: 12,622,114 (GRCm39) E478G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ppp1r12c T A 7: 4,486,983 (GRCm39) T517S probably benign Het
Ptk7 C T 17: 46,883,603 (GRCm39) V821M probably damaging Het
Ptpn6 C T 6: 124,709,913 (GRCm39) V2M probably benign Het
Rgl2 T C 17: 34,152,529 (GRCm39) V380A probably benign Het
Rpl13a-ps1 A G 19: 50,018,591 (GRCm39) V195A possibly damaging Het
Rsph1 C A 17: 31,492,351 (GRCm39) V72F probably benign Het
Sh3bp4 T C 1: 89,073,072 (GRCm39) V640A probably benign Het
Simc1 T A 13: 54,672,795 (GRCm39) V381E probably benign Het
Slc15a3 A T 19: 10,833,296 (GRCm39) T438S probably damaging Het
Slc5a4b C T 10: 75,898,233 (GRCm39) V494M probably benign Het
Sos2 C A 12: 69,674,058 (GRCm39) R335L probably benign Het
Trp53i13 A T 11: 77,399,566 (GRCm39) N254K probably damaging Het
Trpc6 A G 9: 8,609,922 (GRCm39) Y130C probably damaging Het
Trpv1 A G 11: 73,130,415 (GRCm39) I174V probably damaging Het
Tsnax T A 8: 125,742,458 (GRCm39) D62E probably damaging Het
Vezt T A 10: 93,806,193 (GRCm39) E739D probably benign Het
Vmn1r59 T A 7: 5,457,209 (GRCm39) I184F probably damaging Het
Yeats2 T C 16: 20,005,175 (GRCm39) V385A probably benign Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96,708,542 (GRCm39) missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96,718,491 (GRCm39) missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96,710,966 (GRCm39) missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96,713,018 (GRCm39) missense probably benign 0.04
R0218:Nfe2l1 UTSW 11 96,718,439 (GRCm39) missense probably damaging 1.00
R0453:Nfe2l1 UTSW 11 96,718,194 (GRCm39) missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96,718,514 (GRCm39) missense probably damaging 1.00
R3891:Nfe2l1 UTSW 11 96,710,823 (GRCm39) missense possibly damaging 0.93
R4108:Nfe2l1 UTSW 11 96,710,220 (GRCm39) critical splice donor site probably null
R4234:Nfe2l1 UTSW 11 96,710,735 (GRCm39) missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96,718,515 (GRCm39) missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96,712,934 (GRCm39) missense probably damaging 0.99
R5929:Nfe2l1 UTSW 11 96,718,185 (GRCm39) missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96,708,570 (GRCm39) missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96,710,877 (GRCm39) missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96,718,161 (GRCm39) missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96,718,451 (GRCm39) missense probably damaging 1.00
R6907:Nfe2l1 UTSW 11 96,710,636 (GRCm39) missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96,708,546 (GRCm39) missense probably benign 0.23
R7411:Nfe2l1 UTSW 11 96,713,009 (GRCm39) missense probably benign 0.37
R7420:Nfe2l1 UTSW 11 96,710,739 (GRCm39) missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96,710,622 (GRCm39) missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96,710,271 (GRCm39) missense probably damaging 1.00
R8134:Nfe2l1 UTSW 11 96,710,585 (GRCm39) missense possibly damaging 0.83
R8252:Nfe2l1 UTSW 11 96,710,058 (GRCm39) missense probably benign 0.00
R8762:Nfe2l1 UTSW 11 96,711,306 (GRCm39) missense probably damaging 1.00
R8902:Nfe2l1 UTSW 11 96,708,620 (GRCm39) missense unknown
R9074:Nfe2l1 UTSW 11 96,710,573 (GRCm39) missense possibly damaging 0.51
R9084:Nfe2l1 UTSW 11 96,710,957 (GRCm39) missense probably damaging 0.99
R9251:Nfe2l1 UTSW 11 96,710,421 (GRCm39) missense probably damaging 1.00
R9451:Nfe2l1 UTSW 11 96,718,453 (GRCm39) missense probably damaging 0.99
R9472:Nfe2l1 UTSW 11 96,710,159 (GRCm39) missense probably damaging 0.99
R9682:Nfe2l1 UTSW 11 96,710,944 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCAGTTTCGGTCTTAGTGAGC -3'
(R):5'- CAAATACCAGCTGAGCGAGG -3'

Sequencing Primer
(F):5'- GTCTTAGTGAGCGTCCACC -3'
(R):5'- GCCCAGCTCAGCCTCATC -3'
Posted On 2016-07-22