Incidental Mutation 'R5319:Simc1'
ID 406007
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene Name SUMO-interacting motifs containing 1
Synonyms 4732471D19Rik
MMRRC Submission 042902-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5319 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 54651592-54699103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54672795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 381 (V381E)
Ref Sequence ENSEMBL: ENSMUSP00000113676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
AlphaFold E9Q6E9
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121401
AA Change: V381E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: V381E

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123852
Predicted Effect probably benign
Transcript: ENSMUST00000138869
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150011
Predicted Effect probably benign
Transcript: ENSMUST00000159721
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,441,506 (GRCm39) S218P probably benign Het
Ahctf1 A C 1: 179,596,615 (GRCm39) S121A probably damaging Het
Anpep C T 7: 79,491,479 (GRCm39) R174H probably benign Het
Arhgef18 T C 8: 3,435,010 (GRCm39) probably null Het
Becn1 A G 11: 101,179,629 (GRCm39) probably benign Het
Cabin1 T C 10: 75,561,549 (GRCm39) Y984C probably damaging Het
Cacna2d4 G T 6: 119,324,213 (GRCm39) probably null Het
Ccdc14 T G 16: 34,543,542 (GRCm39) N633K probably damaging Het
Cdk5rap1 T A 2: 154,177,489 (GRCm39) T577S possibly damaging Het
Clca4b T C 3: 144,630,940 (GRCm39) R307G possibly damaging Het
Colgalt2 A G 1: 152,360,620 (GRCm39) Q219R possibly damaging Het
Cops3 A T 11: 59,718,762 (GRCm39) D177E possibly damaging Het
Cyp2d9 T C 15: 82,338,256 (GRCm39) Y127H probably damaging Het
Dnajc11 A G 4: 152,052,983 (GRCm39) T98A probably damaging Het
Dst T C 1: 34,265,058 (GRCm39) S4757P possibly damaging Het
Dvl2 C T 11: 69,898,957 (GRCm39) T448I possibly damaging Het
E230016K23Rik T G 11: 83,512,496 (GRCm39) noncoding transcript Het
Efl1 G T 7: 82,323,714 (GRCm39) D219Y probably damaging Het
Epha10 T A 4: 124,807,793 (GRCm39) probably benign Het
Fbxw22 T A 9: 109,213,015 (GRCm39) T311S possibly damaging Het
Folr1 T A 7: 101,513,184 (GRCm39) D37V probably damaging Het
Fshb T A 2: 106,889,224 (GRCm39) I27F probably damaging Het
Gm8521 A T Y: 3,859,335 (GRCm39) noncoding transcript Het
Gpr45 T C 1: 43,071,998 (GRCm39) S214P probably damaging Het
Hgf G A 5: 16,771,860 (GRCm39) probably null Het
Hs6st1 T C 1: 36,143,259 (GRCm39) V398A probably benign Het
Ighmbp2 A G 19: 3,321,646 (GRCm39) V371A probably damaging Het
Kif18a T A 2: 109,148,370 (GRCm39) N621K probably benign Het
Lama5 A G 2: 179,822,911 (GRCm39) F2785S probably damaging Het
Lcor G A 19: 41,574,791 (GRCm39) G1182D probably damaging Het
Lrriq3 T C 3: 154,835,108 (GRCm39) I281T possibly damaging Het
Macf1 C T 4: 123,367,229 (GRCm39) A2511T probably damaging Het
Mark4 T C 7: 19,170,886 (GRCm39) D328G possibly damaging Het
Myo1c G A 11: 75,552,852 (GRCm39) E434K possibly damaging Het
Nfe2l1 A G 11: 96,710,205 (GRCm39) S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 (GRCm38) S272P probably benign Het
Nsrp1 T C 11: 76,940,293 (GRCm39) H104R probably damaging Het
Odf1 T A 15: 38,219,863 (GRCm39) S64T probably benign Het
Or2aa1 A T 11: 59,480,477 (GRCm39) V146E probably damaging Het
Or4c106 T A 2: 88,683,122 (GRCm39) I276K probably damaging Het
Or7g25 C T 9: 19,160,329 (GRCm39) R122H possibly damaging Het
Pde4b C A 4: 102,278,985 (GRCm39) probably benign Het
Phox2a C T 7: 101,470,057 (GRCm39) T96M probably damaging Het
Plg A G 17: 12,622,114 (GRCm39) E478G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ppp1r12c T A 7: 4,486,983 (GRCm39) T517S probably benign Het
Ptk7 C T 17: 46,883,603 (GRCm39) V821M probably damaging Het
Ptpn6 C T 6: 124,709,913 (GRCm39) V2M probably benign Het
Rgl2 T C 17: 34,152,529 (GRCm39) V380A probably benign Het
Rpl13a-ps1 A G 19: 50,018,591 (GRCm39) V195A possibly damaging Het
Rsph1 C A 17: 31,492,351 (GRCm39) V72F probably benign Het
Sh3bp4 T C 1: 89,073,072 (GRCm39) V640A probably benign Het
Slc15a3 A T 19: 10,833,296 (GRCm39) T438S probably damaging Het
Slc5a4b C T 10: 75,898,233 (GRCm39) V494M probably benign Het
Sos2 C A 12: 69,674,058 (GRCm39) R335L probably benign Het
Trp53i13 A T 11: 77,399,566 (GRCm39) N254K probably damaging Het
Trpc6 A G 9: 8,609,922 (GRCm39) Y130C probably damaging Het
Trpv1 A G 11: 73,130,415 (GRCm39) I174V probably damaging Het
Tsnax T A 8: 125,742,458 (GRCm39) D62E probably damaging Het
Vezt T A 10: 93,806,193 (GRCm39) E739D probably benign Het
Vmn1r59 T A 7: 5,457,209 (GRCm39) I184F probably damaging Het
Yeats2 T C 16: 20,005,175 (GRCm39) V385A probably benign Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54,672,989 (GRCm39) missense probably benign 0.27
IGL00813:Simc1 APN 13 54,694,799 (GRCm39) missense probably damaging 0.98
IGL01326:Simc1 APN 13 54,672,473 (GRCm39) missense probably benign 0.00
IGL01587:Simc1 APN 13 54,687,517 (GRCm39) missense probably damaging 1.00
IGL02887:Simc1 APN 13 54,673,071 (GRCm39) missense probably benign 0.04
IGL02977:Simc1 APN 13 54,674,120 (GRCm39) missense probably benign 0.15
IGL03051:Simc1 APN 13 54,674,036 (GRCm39) missense probably benign 0.15
IGL03065:Simc1 APN 13 54,685,025 (GRCm39) missense probably damaging 1.00
IGL03244:Simc1 APN 13 54,698,442 (GRCm39) missense probably benign 0.06
R0158:Simc1 UTSW 13 54,672,530 (GRCm39) missense probably benign 0.00
R0218:Simc1 UTSW 13 54,674,417 (GRCm39) missense probably damaging 1.00
R0241:Simc1 UTSW 13 54,698,338 (GRCm39) missense probably damaging 1.00
R0241:Simc1 UTSW 13 54,698,338 (GRCm39) missense probably damaging 1.00
R0362:Simc1 UTSW 13 54,676,280 (GRCm39) missense probably damaging 1.00
R0464:Simc1 UTSW 13 54,684,913 (GRCm39) nonsense probably null
R0556:Simc1 UTSW 13 54,673,160 (GRCm39) missense probably benign 0.16
R0616:Simc1 UTSW 13 54,694,845 (GRCm39) missense probably benign 0.03
R0686:Simc1 UTSW 13 54,673,003 (GRCm39) missense probably benign 0.31
R0715:Simc1 UTSW 13 54,673,468 (GRCm39) missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54,674,387 (GRCm39) missense probably damaging 1.00
R1335:Simc1 UTSW 13 54,673,078 (GRCm39) intron probably benign
R1344:Simc1 UTSW 13 54,698,292 (GRCm39) missense probably damaging 1.00
R1345:Simc1 UTSW 13 54,673,060 (GRCm39) intron probably benign
R1585:Simc1 UTSW 13 54,673,071 (GRCm39) missense probably benign 0.04
R1633:Simc1 UTSW 13 54,673,044 (GRCm39) missense probably benign 0.05
R1725:Simc1 UTSW 13 54,674,219 (GRCm39) missense probably damaging 0.99
R1826:Simc1 UTSW 13 54,672,452 (GRCm39) missense probably benign 0.00
R1827:Simc1 UTSW 13 54,672,452 (GRCm39) missense probably benign 0.00
R1893:Simc1 UTSW 13 54,687,528 (GRCm39) missense probably damaging 0.99
R2012:Simc1 UTSW 13 54,651,701 (GRCm39) missense probably benign 0.05
R2088:Simc1 UTSW 13 54,689,347 (GRCm39) missense probably damaging 1.00
R2901:Simc1 UTSW 13 54,689,331 (GRCm39) splice site probably null
R2974:Simc1 UTSW 13 54,698,274 (GRCm39) missense probably damaging 1.00
R4238:Simc1 UTSW 13 54,674,073 (GRCm39) nonsense probably null
R4870:Simc1 UTSW 13 54,687,576 (GRCm39) missense probably null 0.73
R4959:Simc1 UTSW 13 54,673,131 (GRCm39) missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54,674,175 (GRCm39) missense probably benign 0.15
R5217:Simc1 UTSW 13 54,687,709 (GRCm39) unclassified probably benign
R5635:Simc1 UTSW 13 54,673,217 (GRCm39) missense probably benign 0.00
R5660:Simc1 UTSW 13 54,694,902 (GRCm39) missense probably benign 0.01
R5900:Simc1 UTSW 13 54,694,837 (GRCm39) missense probably damaging 1.00
R5963:Simc1 UTSW 13 54,673,632 (GRCm39) missense possibly damaging 0.84
R6036:Simc1 UTSW 13 54,672,434 (GRCm39) missense probably benign 0.01
R6036:Simc1 UTSW 13 54,672,434 (GRCm39) missense probably benign 0.01
R6089:Simc1 UTSW 13 54,676,303 (GRCm39) missense probably benign 0.30
R6271:Simc1 UTSW 13 54,687,537 (GRCm39) missense probably damaging 1.00
R6322:Simc1 UTSW 13 54,698,382 (GRCm39) missense probably damaging 1.00
R6364:Simc1 UTSW 13 54,672,413 (GRCm39) nonsense probably null
R6434:Simc1 UTSW 13 54,674,477 (GRCm39) missense probably benign 0.22
R6627:Simc1 UTSW 13 54,694,887 (GRCm39) missense probably damaging 1.00
R6758:Simc1 UTSW 13 54,673,361 (GRCm39) missense possibly damaging 0.57
R7236:Simc1 UTSW 13 54,672,609 (GRCm39) missense probably benign 0.03
R7297:Simc1 UTSW 13 54,673,048 (GRCm39) intron probably benign
R7359:Simc1 UTSW 13 54,651,731 (GRCm39) missense unknown
R7362:Simc1 UTSW 13 54,687,517 (GRCm39) missense probably damaging 1.00
R7490:Simc1 UTSW 13 54,672,162 (GRCm39) missense possibly damaging 0.84
R7792:Simc1 UTSW 13 54,695,143 (GRCm39) missense probably damaging 1.00
R7855:Simc1 UTSW 13 54,672,645 (GRCm39) missense probably benign 0.03
R7869:Simc1 UTSW 13 54,651,713 (GRCm39) missense unknown
R8293:Simc1 UTSW 13 54,674,359 (GRCm39) missense probably damaging 0.98
R8330:Simc1 UTSW 13 54,673,177 (GRCm39) intron probably benign
R8692:Simc1 UTSW 13 54,673,193 (GRCm39) missense probably benign 0.16
R9087:Simc1 UTSW 13 54,672,147 (GRCm39) missense probably benign 0.03
R9449:Simc1 UTSW 13 54,674,192 (GRCm39) missense probably benign 0.15
R9732:Simc1 UTSW 13 54,673,177 (GRCm39) intron probably benign
X0023:Simc1 UTSW 13 54,689,344 (GRCm39) missense probably damaging 0.98
Z1177:Simc1 UTSW 13 54,672,258 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTACCTCAAGATGTTCCAGGC -3'
(R):5'- ATCACACTTCCTGATGACTGC -3'

Sequencing Primer
(F):5'- AAGATGTTCCAGGCCGACCTC -3'
(R):5'- TCCTGATGACTGCATCAC -3'
Posted On 2016-07-22