Incidental Mutation 'R5319:Nr1d2'
ID 406008
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Name nuclear receptor subfamily 1, group D, member 2
Synonyms Rev-erb beta, RVR
MMRRC Submission 042902-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5319 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 4230569-4265642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18215197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 272 (S272P)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
AlphaFold Q60674
Predicted Effect probably benign
Transcript: ENSMUST00000090543
AA Change: S272P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: S272P

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,441,506 (GRCm39) S218P probably benign Het
Ahctf1 A C 1: 179,596,615 (GRCm39) S121A probably damaging Het
Anpep C T 7: 79,491,479 (GRCm39) R174H probably benign Het
Arhgef18 T C 8: 3,435,010 (GRCm39) probably null Het
Becn1 A G 11: 101,179,629 (GRCm39) probably benign Het
Cabin1 T C 10: 75,561,549 (GRCm39) Y984C probably damaging Het
Cacna2d4 G T 6: 119,324,213 (GRCm39) probably null Het
Ccdc14 T G 16: 34,543,542 (GRCm39) N633K probably damaging Het
Cdk5rap1 T A 2: 154,177,489 (GRCm39) T577S possibly damaging Het
Clca4b T C 3: 144,630,940 (GRCm39) R307G possibly damaging Het
Colgalt2 A G 1: 152,360,620 (GRCm39) Q219R possibly damaging Het
Cops3 A T 11: 59,718,762 (GRCm39) D177E possibly damaging Het
Cyp2d9 T C 15: 82,338,256 (GRCm39) Y127H probably damaging Het
Dnajc11 A G 4: 152,052,983 (GRCm39) T98A probably damaging Het
Dst T C 1: 34,265,058 (GRCm39) S4757P possibly damaging Het
Dvl2 C T 11: 69,898,957 (GRCm39) T448I possibly damaging Het
E230016K23Rik T G 11: 83,512,496 (GRCm39) noncoding transcript Het
Efl1 G T 7: 82,323,714 (GRCm39) D219Y probably damaging Het
Epha10 T A 4: 124,807,793 (GRCm39) probably benign Het
Fbxw22 T A 9: 109,213,015 (GRCm39) T311S possibly damaging Het
Folr1 T A 7: 101,513,184 (GRCm39) D37V probably damaging Het
Fshb T A 2: 106,889,224 (GRCm39) I27F probably damaging Het
Gm8521 A T Y: 3,859,335 (GRCm39) noncoding transcript Het
Gpr45 T C 1: 43,071,998 (GRCm39) S214P probably damaging Het
Hgf G A 5: 16,771,860 (GRCm39) probably null Het
Hs6st1 T C 1: 36,143,259 (GRCm39) V398A probably benign Het
Ighmbp2 A G 19: 3,321,646 (GRCm39) V371A probably damaging Het
Kif18a T A 2: 109,148,370 (GRCm39) N621K probably benign Het
Lama5 A G 2: 179,822,911 (GRCm39) F2785S probably damaging Het
Lcor G A 19: 41,574,791 (GRCm39) G1182D probably damaging Het
Lrriq3 T C 3: 154,835,108 (GRCm39) I281T possibly damaging Het
Macf1 C T 4: 123,367,229 (GRCm39) A2511T probably damaging Het
Mark4 T C 7: 19,170,886 (GRCm39) D328G possibly damaging Het
Myo1c G A 11: 75,552,852 (GRCm39) E434K possibly damaging Het
Nfe2l1 A G 11: 96,710,205 (GRCm39) S387P probably damaging Het
Nsrp1 T C 11: 76,940,293 (GRCm39) H104R probably damaging Het
Odf1 T A 15: 38,219,863 (GRCm39) S64T probably benign Het
Or2aa1 A T 11: 59,480,477 (GRCm39) V146E probably damaging Het
Or4c106 T A 2: 88,683,122 (GRCm39) I276K probably damaging Het
Or7g25 C T 9: 19,160,329 (GRCm39) R122H possibly damaging Het
Pde4b C A 4: 102,278,985 (GRCm39) probably benign Het
Phox2a C T 7: 101,470,057 (GRCm39) T96M probably damaging Het
Plg A G 17: 12,622,114 (GRCm39) E478G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ppp1r12c T A 7: 4,486,983 (GRCm39) T517S probably benign Het
Ptk7 C T 17: 46,883,603 (GRCm39) V821M probably damaging Het
Ptpn6 C T 6: 124,709,913 (GRCm39) V2M probably benign Het
Rgl2 T C 17: 34,152,529 (GRCm39) V380A probably benign Het
Rpl13a-ps1 A G 19: 50,018,591 (GRCm39) V195A possibly damaging Het
Rsph1 C A 17: 31,492,351 (GRCm39) V72F probably benign Het
Sh3bp4 T C 1: 89,073,072 (GRCm39) V640A probably benign Het
Simc1 T A 13: 54,672,795 (GRCm39) V381E probably benign Het
Slc15a3 A T 19: 10,833,296 (GRCm39) T438S probably damaging Het
Slc5a4b C T 10: 75,898,233 (GRCm39) V494M probably benign Het
Sos2 C A 12: 69,674,058 (GRCm39) R335L probably benign Het
Trp53i13 A T 11: 77,399,566 (GRCm39) N254K probably damaging Het
Trpc6 A G 9: 8,609,922 (GRCm39) Y130C probably damaging Het
Trpv1 A G 11: 73,130,415 (GRCm39) I174V probably damaging Het
Tsnax T A 8: 125,742,458 (GRCm39) D62E probably damaging Het
Vezt T A 10: 93,806,193 (GRCm39) E739D probably benign Het
Vmn1r59 T A 7: 5,457,209 (GRCm39) I184F probably damaging Het
Yeats2 T C 16: 20,005,175 (GRCm39) V385A probably benign Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18,215,502 (GRCm38) intron probably benign
IGL00897:Nr1d2 APN 14 18,214,993 (GRCm38) missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18,222,011 (GRCm38) missense probably benign
IGL03039:Nr1d2 APN 14 18,215,184 (GRCm38) missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18,216,703 (GRCm38) missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18,215,403 (GRCm38) missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18,215,502 (GRCm38) intron probably benign
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18,215,086 (GRCm38) missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18,211,891 (GRCm38) missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18,215,504 (GRCm38) splice site probably null
R3738:Nr1d2 UTSW 14 18,211,804 (GRCm38) missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18,215,446 (GRCm38) missense probably benign 0.05
R5353:Nr1d2 UTSW 14 18,222,125 (GRCm38) missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18,211,922 (GRCm38) missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18,206,860 (GRCm38) missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18,222,248 (GRCm38) missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18,216,656 (GRCm38) nonsense probably null
R8268:Nr1d2 UTSW 14 18,216,659 (GRCm38) missense probably damaging 1.00
R8411:Nr1d2 UTSW 14 18,215,031 (GRCm38) missense probably damaging 0.98
R8429:Nr1d2 UTSW 14 18,215,409 (GRCm38) missense probably benign 0.10
R8696:Nr1d2 UTSW 14 18,216,661 (GRCm38) missense probably damaging 1.00
R8912:Nr1d2 UTSW 14 18,220,030 (GRCm38) missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18,211,823 (GRCm38) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCACTGGAGAAGTTCATACAGTG -3'
(R):5'- CAGAACAGCATGATCAGTCAGC -3'

Sequencing Primer
(F):5'- TTTGCAATACAAACGGCATGGC -3'
(R):5'- GTCAGCACTACCAGCTCAGG -3'
Posted On 2016-07-22