Incidental Mutation 'R5319:Ccdc14'
ID406013
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Namecoiled-coil domain containing 14
Synonyms
MMRRC Submission 042902-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R5319 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34690616-34725202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34723172 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 633 (N633K)
Ref Sequence ENSEMBL: ENSMUSP00000156124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
Predicted Effect probably damaging
Transcript: ENSMUST00000023532
AA Change: N681K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: N681K

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231364
Predicted Effect probably damaging
Transcript: ENSMUST00000231609
AA Change: N633K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,504,696 S218P probably benign Het
A430078G23Rik T C 8: 3,385,010 probably null Het
Ahctf1 A C 1: 179,769,050 S121A probably damaging Het
Anpep C T 7: 79,841,731 R174H probably benign Het
Becn1 A G 11: 101,288,803 probably benign Het
Cabin1 T C 10: 75,725,715 Y984C probably damaging Het
Cacna2d4 G T 6: 119,347,252 probably null Het
Cdk5rap1 T A 2: 154,335,569 T577S possibly damaging Het
Clca4b T C 3: 144,925,179 R307G possibly damaging Het
Colgalt2 A G 1: 152,484,869 Q219R possibly damaging Het
Cops3 A T 11: 59,827,936 D177E possibly damaging Het
Cyp2d9 T C 15: 82,454,055 Y127H probably damaging Het
Dnajc11 A G 4: 151,968,526 T98A probably damaging Het
Dst T C 1: 34,225,977 S4757P possibly damaging Het
Dvl2 C T 11: 70,008,131 T448I possibly damaging Het
E230016K23Rik T G 11: 83,621,670 noncoding transcript Het
Efl1 G T 7: 82,674,506 D219Y probably damaging Het
Epha10 T A 4: 124,914,000 probably benign Het
Fbxw22 T A 9: 109,383,947 T311S possibly damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Fshb T A 2: 107,058,879 I27F probably damaging Het
Gm340 G A 19: 41,586,352 G1182D probably damaging Het
Gm8521 A T Y: 3,859,335 noncoding transcript Het
Gpr45 T C 1: 43,032,838 S214P probably damaging Het
Hgf G A 5: 16,566,862 probably null Het
Hs6st1 T C 1: 36,104,178 V398A probably benign Het
Ighmbp2 A G 19: 3,271,646 V371A probably damaging Het
Kif18a T A 2: 109,318,025 N621K probably benign Het
Lama5 A G 2: 180,181,118 F2785S probably damaging Het
Lrriq3 T C 3: 155,129,471 I281T possibly damaging Het
Macf1 C T 4: 123,473,436 A2511T probably damaging Het
Mark4 T C 7: 19,436,961 D328G possibly damaging Het
Myo1c G A 11: 75,662,026 E434K possibly damaging Het
Nfe2l1 A G 11: 96,819,379 S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 S272P probably benign Het
Nsrp1 T C 11: 77,049,467 H104R probably damaging Het
Odf1 T A 15: 38,219,619 S64T probably benign Het
Olfr1204 T A 2: 88,852,778 I276K probably damaging Het
Olfr223 A T 11: 59,589,651 V146E probably damaging Het
Olfr843 C T 9: 19,249,033 R122H possibly damaging Het
Pde4b C A 4: 102,421,788 probably benign Het
Phox2a C T 7: 101,820,850 T96M probably damaging Het
Plg A G 17: 12,403,227 E478G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r12c T A 7: 4,483,984 T517S probably benign Het
Ptk7 C T 17: 46,572,677 V821M probably damaging Het
Ptpn6 C T 6: 124,732,950 V2M probably benign Het
Rgl2 T C 17: 33,933,555 V380A probably benign Het
Rpl13a-ps1 A G 19: 50,030,152 V195A possibly damaging Het
Rsph1 C A 17: 31,273,377 V72F probably benign Het
Sh3bp4 T C 1: 89,145,350 V640A probably benign Het
Simc1 T A 13: 54,524,982 V381E probably benign Het
Slc15a3 A T 19: 10,855,932 T438S probably damaging Het
Slc5a4b C T 10: 76,062,399 V494M probably benign Het
Sos2 C A 12: 69,627,284 R335L probably benign Het
Trp53i13 A T 11: 77,508,740 N254K probably damaging Het
Trpc6 A G 9: 8,609,921 Y130C probably damaging Het
Trpv1 A G 11: 73,239,589 I174V probably damaging Het
Tsnax T A 8: 125,015,719 D62E probably damaging Het
Vezt T A 10: 93,970,331 E739D probably benign Het
Vmn1r59 T A 7: 5,454,210 I184F probably damaging Het
Yeats2 T C 16: 20,186,425 V385A probably benign Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2337:Ccdc14 UTSW 16 34705018 missense probably benign 0.04
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4645:Ccdc14 UTSW 16 34721740 missense probably damaging 1.00
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R5945:Ccdc14 UTSW 16 34723588 missense probably damaging 1.00
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6662:Ccdc14 UTSW 16 34690794 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- TCTTGGCAGAACTTTACAGAGC -3'
(R):5'- GTACTGTCCACGTTACACCC -3'

Sequencing Primer
(F):5'- TTTACAGAGCAGCATGGCC -3'
(R):5'- AGGGTTTCACAGTCCATATCG -3'
Posted On2016-07-22