Mutagenetix > Incidental Mutation

Incidental Mutation 'R5319:Ptk7'

406017

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

042902-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46572677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 821 (V821M)

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

AlphaFold

Q8BKG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000044442
AA Change: V821M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: V821M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Meta Mutation Damage Score

0.6888

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	C	5: 146,504,696	S218P	probably benign	Het
A430078G23Rik	T	C	8: 3,385,010		probably null	Het
Ahctf1	A	C	1: 179,769,050	S121A	probably damaging	Het
Anpep	C	T	7: 79,841,731	R174H	probably benign	Het
Becn1	A	G	11: 101,288,803		probably benign	Het
Cabin1	T	C	10: 75,725,715	Y984C	probably damaging	Het
Cacna2d4	G	T	6: 119,347,252		probably null	Het
Ccdc14	T	G	16: 34,723,172	N633K	probably damaging	Het
Cdk5rap1	T	A	2: 154,335,569	T577S	possibly damaging	Het
Clca4b	T	C	3: 144,925,179	R307G	possibly damaging	Het
Colgalt2	A	G	1: 152,484,869	Q219R	possibly damaging	Het
Cops3	A	T	11: 59,827,936	D177E	possibly damaging	Het
Cyp2d9	T	C	15: 82,454,055	Y127H	probably damaging	Het
Dnajc11	A	G	4: 151,968,526	T98A	probably damaging	Het
Dst	T	C	1: 34,225,977	S4757P	possibly damaging	Het
Dvl2	C	T	11: 70,008,131	T448I	possibly damaging	Het
E230016K23Rik	T	G	11: 83,621,670		noncoding transcript	Het
Efl1	G	T	7: 82,674,506	D219Y	probably damaging	Het
Epha10	T	A	4: 124,914,000		probably benign	Het
Fbxw22	T	A	9: 109,383,947	T311S	possibly damaging	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Fshb	T	A	2: 107,058,879	I27F	probably damaging	Het
Gm340	G	A	19: 41,586,352	G1182D	probably damaging	Het
Gm8521	A	T	Y: 3,859,335		noncoding transcript	Het
Gpr45	T	C	1: 43,032,838	S214P	probably damaging	Het
Hgf	G	A	5: 16,566,862		probably null	Het
Hs6st1	T	C	1: 36,104,178	V398A	probably benign	Het
Ighmbp2	A	G	19: 3,271,646	V371A	probably damaging	Het
Kif18a	T	A	2: 109,318,025	N621K	probably benign	Het
Lama5	A	G	2: 180,181,118	F2785S	probably damaging	Het
Lrriq3	T	C	3: 155,129,471	I281T	possibly damaging	Het
Macf1	C	T	4: 123,473,436	A2511T	probably damaging	Het
Mark4	T	C	7: 19,436,961	D328G	possibly damaging	Het
Myo1c	G	A	11: 75,662,026	E434K	possibly damaging	Het
Nfe2l1	A	G	11: 96,819,379	S387P	probably damaging	Het
Nr1d2	A	G	14: 18,215,197	S272P	probably benign	Het
Nsrp1	T	C	11: 77,049,467	H104R	probably damaging	Het
Odf1	T	A	15: 38,219,619	S64T	probably benign	Het
Olfr1204	T	A	2: 88,852,778	I276K	probably damaging	Het
Olfr223	A	T	11: 59,589,651	V146E	probably damaging	Het
Olfr843	C	T	9: 19,249,033	R122H	possibly damaging	Het
Pde4b	C	A	4: 102,421,788		probably benign	Het
Phox2a	C	T	7: 101,820,850	T96M	probably damaging	Het
Plg	A	G	17: 12,403,227	E478G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppp1r12c	T	A	7: 4,483,984	T517S	probably benign	Het
Ptpn6	C	T	6: 124,732,950	V2M	probably benign	Het
Rgl2	T	C	17: 33,933,555	V380A	probably benign	Het
Rpl13a-ps1	A	G	19: 50,030,152	V195A	possibly damaging	Het
Rsph1	C	A	17: 31,273,377	V72F	probably benign	Het
Sh3bp4	T	C	1: 89,145,350	V640A	probably benign	Het
Simc1	T	A	13: 54,524,982	V381E	probably benign	Het
Slc15a3	A	T	19: 10,855,932	T438S	probably damaging	Het
Slc5a4b	C	T	10: 76,062,399	V494M	probably benign	Het
Sos2	C	A	12: 69,627,284	R335L	probably benign	Het
Trp53i13	A	T	11: 77,508,740	N254K	probably damaging	Het
Trpc6	A	G	9: 8,609,921	Y130C	probably damaging	Het
Trpv1	A	G	11: 73,239,589	I174V	probably damaging	Het
Tsnax	T	A	8: 125,015,719	D62E	probably damaging	Het
Vezt	T	A	10: 93,970,331	E739D	probably benign	Het
Vmn1r59	T	A	7: 5,454,210	I184F	probably damaging	Het
Yeats2	T	C	16: 20,186,425	V385A	probably benign	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64
R8773:Ptk7	UTSW	17	46566267	missense	possibly damaging	0.88
R9059:Ptk7	UTSW	17	46566191	missense	probably damaging	1.00
R9327:Ptk7	UTSW	17	46568051	missense	probably benign	0.17
R9495:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82
R9514:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82
R9638:Ptk7	UTSW	17	46579593	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTGACCTCCAGAAAGACGGG -3'
(R):5'- AATGGCTTGGGCACAGTGAG -3'

Sequencing Primer
(F):5'- AAGCTCTGTCTGCGACCAG -3'
(R):5'- GGGCTTGTGCTCTAAGAAAGGC -3'

Posted On

2016-07-22