Incidental Mutation 'R5319:Ighmbp2'
ID406018
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
MMRRC Submission 042902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5319 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3271646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 371 (V371A)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: V371A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: V371A

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119292
AA Change: V371A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: V371A

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143079
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Meta Mutation Damage Score 0.2152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,504,696 S218P probably benign Het
A430078G23Rik T C 8: 3,385,010 probably null Het
Ahctf1 A C 1: 179,769,050 S121A probably damaging Het
Anpep C T 7: 79,841,731 R174H probably benign Het
Becn1 A G 11: 101,288,803 probably benign Het
Cabin1 T C 10: 75,725,715 Y984C probably damaging Het
Cacna2d4 G T 6: 119,347,252 probably null Het
Ccdc14 T G 16: 34,723,172 N633K probably damaging Het
Cdk5rap1 T A 2: 154,335,569 T577S possibly damaging Het
Clca4b T C 3: 144,925,179 R307G possibly damaging Het
Colgalt2 A G 1: 152,484,869 Q219R possibly damaging Het
Cops3 A T 11: 59,827,936 D177E possibly damaging Het
Cyp2d9 T C 15: 82,454,055 Y127H probably damaging Het
Dnajc11 A G 4: 151,968,526 T98A probably damaging Het
Dst T C 1: 34,225,977 S4757P possibly damaging Het
Dvl2 C T 11: 70,008,131 T448I possibly damaging Het
E230016K23Rik T G 11: 83,621,670 noncoding transcript Het
Efl1 G T 7: 82,674,506 D219Y probably damaging Het
Epha10 T A 4: 124,914,000 probably benign Het
Fbxw22 T A 9: 109,383,947 T311S possibly damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Fshb T A 2: 107,058,879 I27F probably damaging Het
Gm340 G A 19: 41,586,352 G1182D probably damaging Het
Gm8521 A T Y: 3,859,335 noncoding transcript Het
Gpr45 T C 1: 43,032,838 S214P probably damaging Het
Hgf G A 5: 16,566,862 probably null Het
Hs6st1 T C 1: 36,104,178 V398A probably benign Het
Kif18a T A 2: 109,318,025 N621K probably benign Het
Lama5 A G 2: 180,181,118 F2785S probably damaging Het
Lrriq3 T C 3: 155,129,471 I281T possibly damaging Het
Macf1 C T 4: 123,473,436 A2511T probably damaging Het
Mark4 T C 7: 19,436,961 D328G possibly damaging Het
Myo1c G A 11: 75,662,026 E434K possibly damaging Het
Nfe2l1 A G 11: 96,819,379 S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 S272P probably benign Het
Nsrp1 T C 11: 77,049,467 H104R probably damaging Het
Odf1 T A 15: 38,219,619 S64T probably benign Het
Olfr1204 T A 2: 88,852,778 I276K probably damaging Het
Olfr223 A T 11: 59,589,651 V146E probably damaging Het
Olfr843 C T 9: 19,249,033 R122H possibly damaging Het
Pde4b C A 4: 102,421,788 probably benign Het
Phox2a C T 7: 101,820,850 T96M probably damaging Het
Plg A G 17: 12,403,227 E478G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r12c T A 7: 4,483,984 T517S probably benign Het
Ptk7 C T 17: 46,572,677 V821M probably damaging Het
Ptpn6 C T 6: 124,732,950 V2M probably benign Het
Rgl2 T C 17: 33,933,555 V380A probably benign Het
Rpl13a-ps1 A G 19: 50,030,152 V195A possibly damaging Het
Rsph1 C A 17: 31,273,377 V72F probably benign Het
Sh3bp4 T C 1: 89,145,350 V640A probably benign Het
Simc1 T A 13: 54,524,982 V381E probably benign Het
Slc15a3 A T 19: 10,855,932 T438S probably damaging Het
Slc5a4b C T 10: 76,062,399 V494M probably benign Het
Sos2 C A 12: 69,627,284 R335L probably benign Het
Trp53i13 A T 11: 77,508,740 N254K probably damaging Het
Trpc6 A G 9: 8,609,921 Y130C probably damaging Het
Trpv1 A G 11: 73,239,589 I174V probably damaging Het
Tsnax T A 8: 125,015,719 D62E probably damaging Het
Vezt T A 10: 93,970,331 E739D probably benign Het
Vmn1r59 T A 7: 5,454,210 I184F probably damaging Het
Yeats2 T C 16: 20,186,425 V385A probably benign Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R7960:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACCAAAGTTCAGCAC -3'
(R):5'- CATCCTCCTATGGCTGTGTG -3'

Sequencing Primer
(F):5'- CTGAGAGCCACGTGACTGAG -3'
(R):5'- GAGAAGGCAGTTCTGTTCTTCCAAC -3'
Posted On2016-07-22