Incidental Mutation 'R5320:Wdr75'
ID406023
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene NameWD repeat domain 75
Synonyms2410118I19Rik, 1300003A18Rik
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R5320 (G1)
Quality Score199
Status Not validated
Chromosome1
Chromosomal Location45795166-45823619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45799051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000117363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139] [ENSMUST00000147308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027139
AA Change: V40A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: V40A

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146602
Predicted Effect probably damaging
Transcript: ENSMUST00000147308
AA Change: V40A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117363
Gene: ENSMUSG00000025995
AA Change: V40A

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45817310 missense probably benign 0.07
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1382:Wdr75 UTSW 1 45817311 missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5255:Wdr75 UTSW 1 45799117 missense probably damaging 1.00
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6341:Wdr75 UTSW 1 45802131 critical splice donor site probably null
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45799087 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 intron probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTCATATCCTCATATGGTTGAC -3'
(R):5'- TAGGAGAACCTACAGATGGACCC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- CACTCCAAATTTAACCCAATTGTTTC -3'
Posted On2016-07-22