Incidental Mutation 'R5320:Cers2'
ID406034
Institutional Source Beutler Lab
Gene Symbol Cers2
Ensembl Gene ENSMUSG00000015714
Gene Nameceramide synthase 2
SynonymsTrh3, 0610013I17Rik, Lass2, CerS2
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95314791-95323599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95320994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 115 (E115G)
Ref Sequence ENSEMBL: ENSMUSP00000120190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139498] [ENSMUST00000139866]
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000015858
AA Change: E115G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714
AA Change: E115G

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Predicted Effect probably null
Transcript: ENSMUST00000129267
AA Change: E115G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714
AA Change: E115G

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
transmembrane domain 136 155 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134702
Predicted Effect probably null
Transcript: ENSMUST00000139498
AA Change: E115G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122672
Gene: ENSMUSG00000015714
AA Change: E115G

DomainStartEndE-ValueType
Pfam:Homeobox 65 127 5.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139866
AA Change: E115G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714
AA Change: E115G

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 246 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156850
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal ceramide species and myelin sheath defects and develop hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Cers2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Cers2 APN 3 95321900 missense probably damaging 1.00
IGL00328:Cers2 APN 3 95320686 missense probably benign 0.37
IGL01561:Cers2 APN 3 95322161 unclassified probably null
IGL02993:Cers2 APN 3 95320085 missense probably benign 0.00
IGL03115:Cers2 APN 3 95321352 missense probably damaging 1.00
IGL03232:Cers2 APN 3 95320157 missense probably damaging 0.97
R0118:Cers2 UTSW 3 95320226 missense probably benign 0.00
R2849:Cers2 UTSW 3 95322459 missense probably benign 0.42
R4709:Cers2 UTSW 3 95320223 missense possibly damaging 0.82
R5662:Cers2 UTSW 3 95320984 missense probably damaging 1.00
R5821:Cers2 UTSW 3 95321697 intron probably benign
R6808:Cers2 UTSW 3 95321009 missense probably benign 0.27
R7049:Cers2 UTSW 3 95321654 missense probably damaging 1.00
R7117:Cers2 UTSW 3 95320761 critical splice donor site probably null
R7388:Cers2 UTSW 3 95321345 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAGATGATTCTGGCAGTTGC -3'
(R):5'- TGGGAGGATCAACAGTTTCCC -3'

Sequencing Primer
(F):5'- CAGAGTTTGAATGCTTGCTTTGGAAG -3'
(R):5'- AGTTTCCCACTGCCCCCAG -3'
Posted On2016-07-22