Incidental Mutation 'R5320:AU040320'
ID406037
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126823716 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 362 (H362L)
Ref Sequence ENSEMBL: ENSMUSP00000037802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047431
AA Change: H362L

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: H362L

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102607
AA Change: H362L

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: H362L

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102608
AA Change: H362L

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: H362L

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141918
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGCTTTGGGGTAGGATCTTAAAAC -3'
(R):5'- AAACAAACACTGGCTGTCCG -3'

Sequencing Primer
(F):5'- CTTAAAACTAAGGCTTTGTCAGGG -3'
(R):5'- CCGCCATGGTGACTTTCTGAAG -3'
Posted On2016-07-22