Incidental Mutation 'R5320:Man2b2'
ID406039
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36810333 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 897 (Y897F)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably damaging
Transcript: ENSMUST00000031002
AA Change: Y897F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: Y897F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect silent
Transcript: ENSMUST00000124711
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147893
AA Change: Y31F
SMART Domains Protein: ENSMUSP00000114319
Gene: ENSMUSG00000029119
AA Change: Y31F

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 2 86 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
R8471:Man2b2 UTSW 5 36821839 missense probably damaging 1.00
R8729:Man2b2 UTSW 5 36816118 missense probably benign 0.25
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTGACTTGACTGCAGG -3'
(R):5'- ATGTGTCGAGAGCAGCTTG -3'

Sequencing Primer
(F):5'- ACTTGACTGCAGGCCTTG -3'
(R):5'- GGCCTGAGGTGTGAACC -3'
Posted On2016-07-22