Mutagenetix > Incidental Mutations

Incidental Mutation 'R0498:Pcm1'

40604

Institutional Source

Beutler Lab

Gene Symbol

Pcm1

Ensembl Gene

ENSMUSG00000031592

Gene Name

pericentriolar material 1

Synonyms

9430077F19Rik, 2600002H09Rik, C030044G17Rik

MMRRC Submission

038694-MU

Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41239752-41332344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41293769 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1335 (S1335N)

Ref Sequence

ENSEMBL: ENSMUSP00000147887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]

Predicted Effect

probably benign
Transcript: ENSMUST00000045218
AA Change: S1296N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: S1296N

Domain	Start	End	E-Value	Type
coiled coil region	218	238	N/A	INTRINSIC
coiled coil region	270	301	N/A	INTRINSIC
coiled coil region	399	426	N/A	INTRINSIC
coiled coil region	492	520	N/A	INTRINSIC
low complexity region	527	548	N/A	INTRINSIC
low complexity region	622	647	N/A	INTRINSIC
coiled coil region	652	683	N/A	INTRINSIC
coiled coil region	724	772	N/A	INTRINSIC
coiled coil region	822	856	N/A	INTRINSIC
coiled coil region	988	1017	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
Pfam:PCM1_C	1369	1999	3.6e-295	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211247
AA Change: S1335N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0587

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,294	D220V	probably benign	Het
4933406M09Rik	A	G	1: 134,390,872	I461V	possibly damaging	Het
6720489N17Rik	T	C	13: 62,607,387	N39S	probably damaging	Het
Adgrf2	A	G	17: 42,714,315		probably benign	Het
Aldh18a1	A	G	19: 40,574,272	V219A	probably benign	Het
Anapc10	A	G	8: 79,774,981	D126G	probably benign	Het
Ap1m2	T	C	9: 21,295,833	*426W	probably null	Het
Arhgap21	A	G	2: 20,863,117	I865T	probably damaging	Het
Armc8	A	G	9: 99,497,292	V527A	probably damaging	Het
Asic5	A	T	3: 82,006,471		probably benign	Het
Baz2b	A	C	2: 59,901,996		probably benign	Het
Bpifa5	T	C	2: 154,167,249	V237A	probably damaging	Het
Brip1	T	A	11: 86,197,919	K52I	possibly damaging	Het
Cacna1g	T	C	11: 94,459,859	I387V	probably damaging	Het
Cbr4	A	G	8: 61,495,073	I135V	probably benign	Het
Ccdc66	C	T	14: 27,500,240		probably null	Het
Cubn	G	A	2: 13,444,267	T999M	probably damaging	Het
Dpp8	C	T	9: 65,045,795		probably benign	Het
Dsg1b	T	C	18: 20,409,333	S966P	possibly damaging	Het
Erp27	T	C	6: 136,919,864		probably benign	Het
Fat4	A	T	3: 38,980,637	I2813L	probably benign	Het
Fhod1	G	A	8: 105,329,856	R1101C	probably damaging	Het
Hoxc9	T	C	15: 102,983,927	S191P	probably damaging	Het
Izumo4	T	C	10: 80,704,196		probably null	Het
Kalrn	C	T	16: 34,054,891	D104N	possibly damaging	Het
Kank4	A	T	4: 98,779,636	D191E	probably benign	Het
Kbtbd11	A	G	8: 15,027,605	E68G	probably benign	Het
Kdr	C	T	5: 75,959,138	V654I	probably benign	Het
Klra1	A	T	6: 130,372,819		probably null	Het
Kmt2e	T	A	5: 23,478,972	Y373*	probably null	Het
Lepr	A	T	4: 101,745,692	M226L	probably benign	Het
Lrp1b	T	A	2: 41,458,405	I800F	probably benign	Het
Lta4h	T	C	10: 93,471,971		probably benign	Het
Map3k7	T	C	4: 31,974,814		probably benign	Het
Map4k4	G	A	1: 39,990,178	R371Q	probably benign	Het
Mme	A	G	3: 63,346,066	I444V	probably damaging	Het
Mms19	C	T	19: 41,949,773	R582Q	possibly damaging	Het
Mtss1	A	G	15: 58,945,437	S502P	probably damaging	Het
Myo3a	G	T	2: 22,577,429	A232S	possibly damaging	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr727	A	C	14: 50,127,293	T239P	probably damaging	Het
Olfr874	G	A	9: 37,746,254	G40E	probably damaging	Het
Pdzph1	A	G	17: 58,973,830	F486L	probably benign	Het
Piezo2	T	C	18: 63,102,174	K552R	possibly damaging	Het
Plekhs1	T	A	19: 56,481,104		probably null	Het
Pprc1	C	T	19: 46,071,568	Q1514*	probably null	Het
Ralgapa1	T	C	12: 55,689,791	T1831A	possibly damaging	Het
Rnpep	G	T	1: 135,265,352	D455E	probably damaging	Het
Rpgrip1	T	A	14: 52,131,314		probably benign	Het
Saxo1	A	T	4: 86,478,896	M135K	possibly damaging	Het
Serpina12	T	C	12: 104,035,789	T223A	probably damaging	Het
Serpinb3a	A	G	1: 107,047,150	F218L	probably damaging	Het
Serpinb9f	T	G	13: 33,326,007		probably benign	Het
Spata33	A	G	8: 123,221,923	D98G	probably benign	Het
Stard13	T	A	5: 151,052,477	Y742F	probably damaging	Het
Tcrg-C3	T	A	13: 19,261,092	M70K	probably damaging	Het
Tecta	A	G	9: 42,377,614	Y552H	probably damaging	Het
Tie1	A	T	4: 118,479,161		probably benign	Het
Tmem161a	A	G	8: 70,180,973	T254A	probably benign	Het
Tmem30a	G	T	9: 79,774,094	Y264*	probably null	Het
Tmem87a	A	T	2: 120,394,465	I105K	probably benign	Het
Tnrc6b	A	T	15: 80,858,719	D51V	probably damaging	Het
Trpc4	T	C	3: 54,291,211	F519L	probably damaging	Het
Ttn	T	C	2: 76,709,581	T26027A	probably damaging	Het
Vmn1r198	A	C	13: 22,354,974	H121P	probably damaging	Het
Vps33a	A	G	5: 123,570,961	F64L	probably benign	Het
Wdr63	G	T	3: 146,081,364	D305E	possibly damaging	Het
Zfp994	A	T	17: 22,200,901	C356S	probably damaging	Het

Other mutations in Pcm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Pcm1	APN	8	41274277	missense	probably damaging	1.00
IGL00852:Pcm1	APN	8	41287821	missense	probably damaging	1.00
IGL00896:Pcm1	APN	8	41276123	missense	possibly damaging	0.70
IGL00927:Pcm1	APN	8	41287881	missense	probably damaging	1.00
IGL01085:Pcm1	APN	8	41309603	missense	probably damaging	1.00
IGL01684:Pcm1	APN	8	41257923	missense	probably benign	0.00
IGL01888:Pcm1	APN	8	41257956	missense	probably damaging	0.98
IGL02349:Pcm1	APN	8	41288155	critical splice donor site	probably null
IGL02562:Pcm1	APN	8	41325368	missense	probably damaging	1.00
IGL02807:Pcm1	APN	8	41330882	missense	probably damaging	1.00
IGL03081:Pcm1	APN	8	41275060	missense	probably damaging	1.00
shaved	UTSW	8	41288156	critical splice donor site	probably null
D3080:Pcm1	UTSW	8	41275939	missense	probably damaging	1.00
P0045:Pcm1	UTSW	8	41288097	missense	probably damaging	0.99
R0090:Pcm1	UTSW	8	41256041	missense	probably damaging	0.99
R0109:Pcm1	UTSW	8	41257937	missense	possibly damaging	0.88
R0373:Pcm1	UTSW	8	41276111	nonsense	probably null
R0386:Pcm1	UTSW	8	41316023	missense	probably damaging	1.00
R0452:Pcm1	UTSW	8	41325905	missense	probably benign	0.25
R0528:Pcm1	UTSW	8	41315930	missense	probably damaging	1.00
R0587:Pcm1	UTSW	8	41286051	missense	probably damaging	0.99
R0635:Pcm1	UTSW	8	41267179	splice site	probably benign
R0725:Pcm1	UTSW	8	41287811	missense	probably damaging	1.00
R0762:Pcm1	UTSW	8	41261020	missense	probably damaging	1.00
R0848:Pcm1	UTSW	8	41282683	missense	probably damaging	1.00
R1027:Pcm1	UTSW	8	41293445	splice site	probably benign
R1056:Pcm1	UTSW	8	41321900	missense	probably damaging	1.00
R1534:Pcm1	UTSW	8	41287701	missense	probably benign
R1566:Pcm1	UTSW	8	41290773	missense	probably damaging	1.00
R1595:Pcm1	UTSW	8	41309635	missense	probably damaging	1.00
R1719:Pcm1	UTSW	8	41313359	missense	possibly damaging	0.62
R1816:Pcm1	UTSW	8	41309537	missense	probably damaging	0.99
R2177:Pcm1	UTSW	8	41275965	missense	probably benign
R2495:Pcm1	UTSW	8	41293579	missense	probably benign
R3737:Pcm1	UTSW	8	41261043	nonsense	probably null
R3747:Pcm1	UTSW	8	41332004	missense	probably benign	0.44
R3763:Pcm1	UTSW	8	41280077	missense	probably damaging	1.00
R3764:Pcm1	UTSW	8	41330882	missense	probably damaging	1.00
R3798:Pcm1	UTSW	8	41258014	missense	possibly damaging	0.66
R3968:Pcm1	UTSW	8	41325830	missense	probably damaging	1.00
R4760:Pcm1	UTSW	8	41287738	missense	probably damaging	0.99
R4798:Pcm1	UTSW	8	41293678	missense	probably damaging	1.00
R5062:Pcm1	UTSW	8	41259260	missense	probably damaging	0.99
R5221:Pcm1	UTSW	8	41288156	critical splice donor site	probably null
R5250:Pcm1	UTSW	8	41312205	missense	probably damaging	0.99
R5466:Pcm1	UTSW	8	41272462	critical splice donor site	probably null
R5470:Pcm1	UTSW	8	41287683	missense	probably damaging	1.00
R5958:Pcm1	UTSW	8	41328979	missense	probably damaging	1.00
R6043:Pcm1	UTSW	8	41328778	missense	possibly damaging	0.54
R6179:Pcm1	UTSW	8	41283632	missense	probably damaging	0.99
R6186:Pcm1	UTSW	8	41293793	missense	probably benign	0.23
R6227:Pcm1	UTSW	8	41330825	missense	probably damaging	0.99
R6368:Pcm1	UTSW	8	41293544	missense	probably benign	0.09
R6438:Pcm1	UTSW	8	41325381	missense	possibly damaging	0.94
R6459:Pcm1	UTSW	8	41261036	missense	probably damaging	1.00
R7399:Pcm1	UTSW	8	41293510	missense	probably benign	0.11
R7401:Pcm1	UTSW	8	41309531	missense	probably damaging	1.00
R7478:Pcm1	UTSW	8	41261373	missense	probably benign	0.17
R7570:Pcm1	UTSW	8	41267344	missense	possibly damaging	0.64
R7648:Pcm1	UTSW	8	41275699	missense	probably damaging	0.99
R7773:Pcm1	UTSW	8	41309573	nonsense	probably null
R7779:Pcm1	UTSW	8	41329024	missense	probably damaging	1.00
X0025:Pcm1	UTSW	8	41330642	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACACTTGCTGGGCTCTCTGATTAAAA -3'
(R):5'- GAAGCAGCTTTCTACAATGCCTGTAGAT -3'

Sequencing Primer
(F):5'- TTTTGGTAAGGAATCAGAAACAGCC -3'
(R):5'- GGCAAAGTAACAAGACCAAGGTTT -3'

Posted On

2013-05-23