Incidental Mutation 'R5320:Slc6a15'
ID 406065
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 042903-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5320 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103244067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 436 (V436L)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: V436L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V436L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: V436L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V436L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,541 (GRCm39) I581N probably damaging Het
Abcb10 A G 8: 124,697,763 (GRCm39) F187S probably benign Het
Actl11 T A 9: 107,808,203 (GRCm39) V842E possibly damaging Het
Akap12 A G 10: 4,307,291 (GRCm39) D1367G probably benign Het
Aoc1l1 T A 6: 48,952,474 (GRCm39) L133Q probably damaging Het
Aoc1l3 T A 6: 48,964,509 (GRCm39) F172L probably benign Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bmpr1a C T 14: 34,146,999 (GRCm39) V258M probably damaging Het
Bptf T A 11: 106,972,193 (GRCm39) K892* probably null Het
Cap2 A G 13: 46,801,840 (GRCm39) *422W probably null Het
Cars2 G T 8: 11,567,854 (GRCm39) H414N probably benign Het
Ccnt1 A C 15: 98,442,124 (GRCm39) S381R probably benign Het
Cdyl2 A T 8: 117,321,794 (GRCm39) C244* probably null Het
Cers2 A G 3: 95,228,305 (GRCm39) E115G probably null Het
Cpt1b G A 15: 89,303,477 (GRCm39) P553S probably benign Het
Cuedc1 A G 11: 88,068,136 (GRCm39) E128G probably damaging Het
Dll4 T A 2: 119,156,968 (GRCm39) V80D probably damaging Het
Dop1b T C 16: 93,536,874 (GRCm39) L113P probably damaging Het
Fam98a A G 17: 75,845,810 (GRCm39) I312T probably damaging Het
Gnrhr T G 5: 86,345,473 (GRCm39) K71T possibly damaging Het
Gtf3c3 A T 1: 54,445,032 (GRCm39) L674Q probably damaging Het
Hipk2 A T 6: 38,795,212 (GRCm39) H352Q probably damaging Het
Hivep1 T C 13: 42,313,115 (GRCm39) V1785A probably damaging Het
Hspa4 A T 11: 53,153,810 (GRCm39) I687N probably damaging Het
Krt18 A T 15: 101,936,955 (GRCm39) D81V probably damaging Het
Lama3 A C 18: 12,685,912 (GRCm39) D1142A probably damaging Het
Lnpep A G 17: 17,766,727 (GRCm39) I713T possibly damaging Het
Man2b2 T A 5: 36,967,677 (GRCm39) Y897F probably damaging Het
Muc5b A T 7: 141,412,738 (GRCm39) I1895F unknown Het
Myh8 G A 11: 67,177,089 (GRCm39) V414I probably damaging Het
Myo1d A T 11: 80,575,149 (GRCm39) probably null Het
Nav2 A T 7: 49,141,121 (GRCm39) M889L probably benign Het
Oc90 C T 15: 65,754,457 (GRCm39) G236D probably benign Het
Or13a27 A G 7: 139,925,548 (GRCm39) V118A probably benign Het
Pak4 A G 7: 28,267,631 (GRCm39) I11T probably damaging Het
Papss2 T C 19: 32,615,787 (GRCm39) I173T probably damaging Het
Pcsk9 A T 4: 106,320,988 (GRCm39) D40E probably benign Het
Pdzrn3 G C 6: 101,128,064 (GRCm39) H867Q probably damaging Het
Plcb1 A T 2: 135,094,696 (GRCm39) I174F possibly damaging Het
Pom121l2 G A 13: 22,166,015 (GRCm39) W95* probably null Het
Prcp A T 7: 92,577,843 (GRCm39) T336S probably benign Het
Prdm11 A C 2: 92,843,226 (GRCm39) S78A probably benign Het
Ralgds T C 2: 28,435,224 (GRCm39) I405T probably damaging Het
Rasgrf1 A G 9: 89,902,478 (GRCm39) R1208G probably damaging Het
Rasgrp2 T A 19: 6,458,864 (GRCm39) probably null Het
Rb1 A T 14: 73,450,566 (GRCm39) Y599* probably null Het
Rnf141 A T 7: 110,433,010 (GRCm39) F62L probably damaging Het
Rsl24d1 T A 9: 73,023,698 (GRCm39) F292I possibly damaging Het
Scn10a C T 9: 119,477,175 (GRCm39) V736I probably damaging Het
Sim2 A T 16: 93,905,598 (GRCm39) T141S probably benign Het
Smarca2 T C 19: 26,668,772 (GRCm39) S924P probably damaging Het
Tacc1 T C 8: 25,671,881 (GRCm39) E449G probably benign Het
Tlr3 A T 8: 45,852,137 (GRCm39) N253K possibly damaging Het
Tmem198 G A 1: 75,456,500 (GRCm39) A82T probably benign Het
Tom1l2 A T 11: 60,133,648 (GRCm39) L54* probably null Het
Trav12-2 A G 14: 53,854,356 (GRCm39) Y110C probably benign Het
Trdn T A 10: 33,209,247 (GRCm39) probably null Het
Trim36 G T 18: 46,300,565 (GRCm39) P690Q probably damaging Het
Trpc4 A T 3: 54,206,599 (GRCm39) M600L probably damaging Het
Trpm2 T A 10: 77,759,355 (GRCm39) Q1143L probably benign Het
Usp34 T A 11: 23,283,739 (GRCm39) D144E probably benign Het
Vps18 A T 2: 119,127,858 (GRCm39) R894* probably null Het
Vwa1 A G 4: 155,855,369 (GRCm39) V248A probably benign Het
Wdr75 T C 1: 45,838,211 (GRCm39) V40A probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACTCTTTGGGTCCAGGCAATG -3'
(R):5'- TGGGCTACATTGAAGTCAAGAG -3'

Sequencing Primer
(F):5'- TGAGCACATAACTTAAGGAATAAAGC -3'
(R):5'- AGTCAAGAGTAATATCTCACCAGTG -3'
Posted On 2016-07-22