Incidental Mutation 'R5320:Slc6a15'
ID 406065
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 042903-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5320 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103408206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 436 (V436L)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: V436L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V436L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: V436L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V436L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACTCTTTGGGTCCAGGCAATG -3'
(R):5'- TGGGCTACATTGAAGTCAAGAG -3'

Sequencing Primer
(F):5'- TGAGCACATAACTTAAGGAATAAAGC -3'
(R):5'- AGTCAAGAGTAATATCTCACCAGTG -3'
Posted On 2016-07-22