Incidental Mutation 'R5320:Myo1d'
ID 406071
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms D11Ertd9e, 9930104H07Rik
MMRRC Submission 042903-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5320 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 80372952-80670851 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 80575149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000041065] [ENSMUST00000070997]
AlphaFold Q5SYD0
Predicted Effect probably null
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000070997
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125944
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,541 (GRCm39) I581N probably damaging Het
Abcb10 A G 8: 124,697,763 (GRCm39) F187S probably benign Het
Actl11 T A 9: 107,808,203 (GRCm39) V842E possibly damaging Het
Akap12 A G 10: 4,307,291 (GRCm39) D1367G probably benign Het
Aoc1l1 T A 6: 48,952,474 (GRCm39) L133Q probably damaging Het
Aoc1l3 T A 6: 48,964,509 (GRCm39) F172L probably benign Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bmpr1a C T 14: 34,146,999 (GRCm39) V258M probably damaging Het
Bptf T A 11: 106,972,193 (GRCm39) K892* probably null Het
Cap2 A G 13: 46,801,840 (GRCm39) *422W probably null Het
Cars2 G T 8: 11,567,854 (GRCm39) H414N probably benign Het
Ccnt1 A C 15: 98,442,124 (GRCm39) S381R probably benign Het
Cdyl2 A T 8: 117,321,794 (GRCm39) C244* probably null Het
Cers2 A G 3: 95,228,305 (GRCm39) E115G probably null Het
Cpt1b G A 15: 89,303,477 (GRCm39) P553S probably benign Het
Cuedc1 A G 11: 88,068,136 (GRCm39) E128G probably damaging Het
Dll4 T A 2: 119,156,968 (GRCm39) V80D probably damaging Het
Dop1b T C 16: 93,536,874 (GRCm39) L113P probably damaging Het
Fam98a A G 17: 75,845,810 (GRCm39) I312T probably damaging Het
Gnrhr T G 5: 86,345,473 (GRCm39) K71T possibly damaging Het
Gtf3c3 A T 1: 54,445,032 (GRCm39) L674Q probably damaging Het
Hipk2 A T 6: 38,795,212 (GRCm39) H352Q probably damaging Het
Hivep1 T C 13: 42,313,115 (GRCm39) V1785A probably damaging Het
Hspa4 A T 11: 53,153,810 (GRCm39) I687N probably damaging Het
Krt18 A T 15: 101,936,955 (GRCm39) D81V probably damaging Het
Lama3 A C 18: 12,685,912 (GRCm39) D1142A probably damaging Het
Lnpep A G 17: 17,766,727 (GRCm39) I713T possibly damaging Het
Man2b2 T A 5: 36,967,677 (GRCm39) Y897F probably damaging Het
Muc5b A T 7: 141,412,738 (GRCm39) I1895F unknown Het
Myh8 G A 11: 67,177,089 (GRCm39) V414I probably damaging Het
Nav2 A T 7: 49,141,121 (GRCm39) M889L probably benign Het
Oc90 C T 15: 65,754,457 (GRCm39) G236D probably benign Het
Or13a27 A G 7: 139,925,548 (GRCm39) V118A probably benign Het
Pak4 A G 7: 28,267,631 (GRCm39) I11T probably damaging Het
Papss2 T C 19: 32,615,787 (GRCm39) I173T probably damaging Het
Pcsk9 A T 4: 106,320,988 (GRCm39) D40E probably benign Het
Pdzrn3 G C 6: 101,128,064 (GRCm39) H867Q probably damaging Het
Plcb1 A T 2: 135,094,696 (GRCm39) I174F possibly damaging Het
Pom121l2 G A 13: 22,166,015 (GRCm39) W95* probably null Het
Prcp A T 7: 92,577,843 (GRCm39) T336S probably benign Het
Prdm11 A C 2: 92,843,226 (GRCm39) S78A probably benign Het
Ralgds T C 2: 28,435,224 (GRCm39) I405T probably damaging Het
Rasgrf1 A G 9: 89,902,478 (GRCm39) R1208G probably damaging Het
Rasgrp2 T A 19: 6,458,864 (GRCm39) probably null Het
Rb1 A T 14: 73,450,566 (GRCm39) Y599* probably null Het
Rnf141 A T 7: 110,433,010 (GRCm39) F62L probably damaging Het
Rsl24d1 T A 9: 73,023,698 (GRCm39) F292I possibly damaging Het
Scn10a C T 9: 119,477,175 (GRCm39) V736I probably damaging Het
Sim2 A T 16: 93,905,598 (GRCm39) T141S probably benign Het
Slc6a15 G T 10: 103,244,067 (GRCm39) V436L probably damaging Het
Smarca2 T C 19: 26,668,772 (GRCm39) S924P probably damaging Het
Tacc1 T C 8: 25,671,881 (GRCm39) E449G probably benign Het
Tlr3 A T 8: 45,852,137 (GRCm39) N253K possibly damaging Het
Tmem198 G A 1: 75,456,500 (GRCm39) A82T probably benign Het
Tom1l2 A T 11: 60,133,648 (GRCm39) L54* probably null Het
Trav12-2 A G 14: 53,854,356 (GRCm39) Y110C probably benign Het
Trdn T A 10: 33,209,247 (GRCm39) probably null Het
Trim36 G T 18: 46,300,565 (GRCm39) P690Q probably damaging Het
Trpc4 A T 3: 54,206,599 (GRCm39) M600L probably damaging Het
Trpm2 T A 10: 77,759,355 (GRCm39) Q1143L probably benign Het
Usp34 T A 11: 23,283,739 (GRCm39) D144E probably benign Het
Vps18 A T 2: 119,127,858 (GRCm39) R894* probably null Het
Vwa1 A G 4: 155,855,369 (GRCm39) V248A probably benign Het
Wdr75 T C 1: 45,838,211 (GRCm39) V40A probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80,492,566 (GRCm39) missense probably benign
IGL01087:Myo1d APN 11 80,573,261 (GRCm39) missense probably damaging 1.00
IGL01326:Myo1d APN 11 80,575,147 (GRCm39) splice site probably benign
IGL01431:Myo1d APN 11 80,565,665 (GRCm39) missense probably damaging 1.00
IGL01595:Myo1d APN 11 80,566,936 (GRCm39) missense probably benign 0.00
IGL01811:Myo1d APN 11 80,583,823 (GRCm39) missense probably damaging 0.96
IGL02301:Myo1d APN 11 80,567,679 (GRCm39) missense probably benign 0.23
IGL02388:Myo1d APN 11 80,528,823 (GRCm39) nonsense probably null
IGL02485:Myo1d APN 11 80,557,407 (GRCm39) missense probably damaging 1.00
IGL03017:Myo1d APN 11 80,492,452 (GRCm39) missense probably benign 0.26
horton UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
multifaceted UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
whisper UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
whisper2 UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
whisper3 UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0081:Myo1d UTSW 11 80,448,349 (GRCm39) missense probably benign 0.00
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0244:Myo1d UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
R0711:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0746:Myo1d UTSW 11 80,477,705 (GRCm39) missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80,575,221 (GRCm39) missense probably damaging 1.00
R1514:Myo1d UTSW 11 80,576,734 (GRCm39) missense probably damaging 0.97
R1676:Myo1d UTSW 11 80,575,247 (GRCm39) missense probably damaging 1.00
R1862:Myo1d UTSW 11 80,553,874 (GRCm39) missense probably damaging 1.00
R2497:Myo1d UTSW 11 80,565,647 (GRCm39) missense probably damaging 1.00
R2512:Myo1d UTSW 11 80,670,543 (GRCm39) missense probably benign 0.00
R3425:Myo1d UTSW 11 80,492,464 (GRCm39) missense probably benign
R3429:Myo1d UTSW 11 80,573,236 (GRCm39) missense probably damaging 1.00
R3917:Myo1d UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
R3928:Myo1d UTSW 11 80,375,087 (GRCm39) missense probably benign 0.09
R4706:Myo1d UTSW 11 80,557,467 (GRCm39) missense probably damaging 0.96
R4723:Myo1d UTSW 11 80,670,667 (GRCm39) utr 5 prime probably benign
R4924:Myo1d UTSW 11 80,565,504 (GRCm39) missense probably damaging 1.00
R5042:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R5481:Myo1d UTSW 11 80,553,921 (GRCm39) missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80,670,617 (GRCm39) start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80,583,770 (GRCm39) missense probably benign 0.23
R6282:Myo1d UTSW 11 80,448,338 (GRCm39) missense probably damaging 0.99
R6468:Myo1d UTSW 11 80,448,300 (GRCm39) missense probably benign 0.00
R6668:Myo1d UTSW 11 80,474,701 (GRCm39) intron probably benign
R6954:Myo1d UTSW 11 80,565,783 (GRCm39) missense probably benign 0.21
R7077:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7078:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7080:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7172:Myo1d UTSW 11 80,483,621 (GRCm39) missense probably benign 0.16
R7276:Myo1d UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
R7467:Myo1d UTSW 11 80,477,743 (GRCm39) missense probably damaging 1.00
R7650:Myo1d UTSW 11 80,492,510 (GRCm39) missense probably benign
R7678:Myo1d UTSW 11 80,567,719 (GRCm39) missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80,575,203 (GRCm39) missense probably damaging 1.00
R8324:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R8329:Myo1d UTSW 11 80,528,900 (GRCm39) missense probably benign 0.21
R8474:Myo1d UTSW 11 80,561,745 (GRCm39) missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80,575,205 (GRCm39) missense probably damaging 1.00
R8810:Myo1d UTSW 11 80,567,758 (GRCm39) missense probably benign 0.30
R8810:Myo1d UTSW 11 80,565,758 (GRCm39) missense probably damaging 1.00
R8823:Myo1d UTSW 11 80,492,571 (GRCm39) missense possibly damaging 0.91
R9221:Myo1d UTSW 11 80,565,744 (GRCm39) missense probably damaging 1.00
R9494:Myo1d UTSW 11 80,375,093 (GRCm39) missense probably benign 0.02
R9625:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9628:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80,565,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTGACTCGATGCACTAAG -3'
(R):5'- GGCTAGGATGACAGTAAGATCATC -3'

Sequencing Primer
(F):5'- CTGACTCGATGCACTAAGTGTTCATG -3'
(R):5'- GATGACAGTAAGATCATCCAGTTTTC -3'
Posted On 2016-07-22