Incidental Mutation 'R5320:Ccnt1'
ID406083
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Namecyclin T1
Synonyms2810478G24Rik, CycT1
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98538689-98570923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98544243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 381 (S381R)
Ref Sequence ENSEMBL: ENSMUSP00000126874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000168928] [ENSMUST00000169707]
Predicted Effect probably benign
Transcript: ENSMUST00000012104
AA Change: S381R

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960
AA Change: S381R

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164565
Predicted Effect probably benign
Transcript: ENSMUST00000168928
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169674
Predicted Effect probably benign
Transcript: ENSMUST00000169707
AA Change: S381R

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960
AA Change: S381R

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170452
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98565109 missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98554633 missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98544241 missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98567603 missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98546783 missense possibly damaging 0.92
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98544338 missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2068:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98543600 missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98544059 missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98544308 missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98543451 missense probably damaging 1.00
R4836:Ccnt1 UTSW 15 98567563 missense probably damaging 0.96
R5740:Ccnt1 UTSW 15 98544500 missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98543513 nonsense probably null
R6074:Ccnt1 UTSW 15 98543324 missense probably damaging 1.00
R6413:Ccnt1 UTSW 15 98543969 missense probably benign 0.01
R6610:Ccnt1 UTSW 15 98565101 missense probably damaging 1.00
R7260:Ccnt1 UTSW 15 98565124 nonsense probably null
R7752:Ccnt1 UTSW 15 98543916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAAAGGACGTTCAGG -3'
(R):5'- TCTGAGGAGTCATCGAGCAG -3'

Sequencing Primer
(F):5'- CCAGAAAAGGACGTTCAGGGTTTTC -3'
(R):5'- CATCGAGCAGTCTAACTAGTGTG -3'
Posted On2016-07-22