Incidental Mutation 'R5320:Trim36'
ID406092
Institutional Source Beutler Lab
Gene Symbol Trim36
Ensembl Gene ENSMUSG00000033949
Gene Nametripartite motif-containing 36
SynonymsHaprin, D18Wsu100e
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location46165302-46212607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46167498 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 690 (P690Q)
Ref Sequence ENSEMBL: ENSMUSP00000129771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037011] [ENSMUST00000167364]
Predicted Effect probably damaging
Transcript: ENSMUST00000037011
AA Change: P702Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037978
Gene: ENSMUSG00000033949
AA Change: P702Q

DomainStartEndE-ValueType
RING 33 118 1.25e-5 SMART
BBOX 207 249 1.82e-7 SMART
Blast:BBC 256 381 5e-11 BLAST
FN3 418 498 1.32e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167364
AA Change: P690Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129771
Gene: ENSMUSG00000033949
AA Change: P690Q

DomainStartEndE-ValueType
RING 21 106 1.25e-5 SMART
BBOX 195 237 1.82e-7 SMART
Blast:BBC 244 369 4e-11 BLAST
FN3 406 486 1.32e-1 SMART
Pfam:SPRY 560 704 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Trim36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Trim36 APN 18 46188388 splice site probably benign
IGL02728:Trim36 APN 18 46172602 missense probably benign 0.00
IGL03166:Trim36 APN 18 46212321 missense probably benign
IGL03209:Trim36 APN 18 46167508 missense probably benign
R0346:Trim36 UTSW 18 46199709 unclassified probably benign
R0426:Trim36 UTSW 18 46172525 missense probably damaging 0.97
R0463:Trim36 UTSW 18 46178456 missense possibly damaging 0.89
R0590:Trim36 UTSW 18 46172576 missense probably benign 0.01
R0751:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1037:Trim36 UTSW 18 46196318 splice site probably benign
R1184:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1522:Trim36 UTSW 18 46186183 nonsense probably null
R1571:Trim36 UTSW 18 46172495 missense probably benign 0.01
R1687:Trim36 UTSW 18 46188657 missense possibly damaging 0.93
R2057:Trim36 UTSW 18 46196162 missense probably benign 0.02
R2103:Trim36 UTSW 18 46196082 missense probably benign
R2127:Trim36 UTSW 18 46212337 missense probably benign 0.27
R3853:Trim36 UTSW 18 46172372 splice site probably benign
R4209:Trim36 UTSW 18 46196124 missense probably benign 0.44
R4787:Trim36 UTSW 18 46172532 missense probably benign 0.10
R4810:Trim36 UTSW 18 46172469 missense probably benign 0.07
R4953:Trim36 UTSW 18 46196178 missense possibly damaging 0.90
R5107:Trim36 UTSW 18 46172638 missense probably benign
R5683:Trim36 UTSW 18 46169292 missense probably damaging 1.00
R5823:Trim36 UTSW 18 46169340 missense probably damaging 1.00
R6619:Trim36 UTSW 18 46188408 missense probably damaging 0.96
R7349:Trim36 UTSW 18 46169428 missense probably benign 0.29
R7814:Trim36 UTSW 18 46167624 missense possibly damaging 0.64
R7853:Trim36 UTSW 18 46172491 missense probably benign 0.14
R8008:Trim36 UTSW 18 46172489 missense probably benign 0.34
R8294:Trim36 UTSW 18 46198521 missense probably benign 0.02
R8735:Trim36 UTSW 18 46169385 missense probably benign 0.10
R8899:Trim36 UTSW 18 46169197 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGTACAAACAGGTGTGGTGAC -3'
(R):5'- CGAGGACGCCTGTTTTGATTC -3'

Sequencing Primer
(F):5'- TGGTGACAGAGACGTAAATGATATG -3'
(R):5'- GAGGACGCCTGTTTTGATTCTTCAC -3'
Posted On2016-07-22