Incidental Mutation 'R5320:Rasgrp2'
ID406093
Institutional Source Beutler Lab
Gene Symbol Rasgrp2
Ensembl Gene ENSMUSG00000032946
Gene NameRAS, guanyl releasing protein 2
SynonymsCaldaggef1, CalDAG-GEFI
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6399340-6415216 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 6408834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035716] [ENSMUST00000035716] [ENSMUST00000113476] [ENSMUST00000113476] [ENSMUST00000127021] [ENSMUST00000138555] [ENSMUST00000139522] [ENSMUST00000146831] [ENSMUST00000167240] [ENSMUST00000167240]
Predicted Effect probably null
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124118
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135532
Predicted Effect probably benign
Transcript: ENSMUST00000138555
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152022
Predicted Effect probably null
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not undergo spontaneous hemorrhaging but exhibit impaired platelet aggregation, resistance to collagen-induced thrombosis, and increased bleeding times after tail transection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Rasgrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Rasgrp2 APN 19 6404383 missense probably damaging 1.00
IGL03053:Rasgrp2 APN 19 6407332 splice site probably benign
thither UTSW 19 6404727 missense probably damaging 1.00
R1593:Rasgrp2 UTSW 19 6403460 missense possibly damaging 0.77
R1604:Rasgrp2 UTSW 19 6407057 missense possibly damaging 0.62
R2016:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2017:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2119:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2120:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2122:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2124:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R3879:Rasgrp2 UTSW 19 6413890 missense probably benign 0.07
R4049:Rasgrp2 UTSW 19 6404727 missense probably damaging 1.00
R4655:Rasgrp2 UTSW 19 6404846 intron probably benign
R5250:Rasgrp2 UTSW 19 6404313 missense probably damaging 1.00
R5620:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
R5933:Rasgrp2 UTSW 19 6402513 missense probably damaging 1.00
R6155:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6157:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6867:Rasgrp2 UTSW 19 6413183 missense probably benign 0.00
R7237:Rasgrp2 UTSW 19 6404808 missense possibly damaging 0.79
R7575:Rasgrp2 UTSW 19 6404367 missense probably damaging 0.99
R7659:Rasgrp2 UTSW 19 6401827 missense probably damaging 0.98
R7744:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAGTGCTAACCATCCC -3'
(R):5'- TTCTCTTTGCCAGGCTCAGG -3'

Sequencing Primer
(F):5'- GTGCTAACCATCCCCAGCAG -3'
(R):5'- TCTAGGACTGGCAGCTTCC -3'
Posted On2016-07-22