Incidental Mutation 'R5321:Tdrkh'
ID406100
Institutional Source Beutler Lab
Gene Symbol Tdrkh
Ensembl Gene ENSMUSG00000041912
Gene Nametudor and KH domain containing protein
Synonyms2700091C21Rik, Tdrd2
MMRRC Submission 042904-MU
Accession Numbers

Genbank: NM_028307; MGI: 1919884

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94413273-94434668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94425658 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 169 (L169I)
Ref Sequence ENSEMBL: ENSMUSP00000143102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000196386] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197876] [ENSMUST00000197901] [ENSMUST00000200486]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045245
AA Change: L173I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912
AA Change: L173I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166032
AA Change: L173I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912
AA Change: L173I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196386
AA Change: D139E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143256
Gene: ENSMUSG00000041912
AA Change: D139E

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
KH 51 120 2.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196606
AA Change: L169I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912
AA Change: L169I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196717
Predicted Effect possibly damaging
Transcript: ENSMUST00000197495
AA Change: L128I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912
AA Change: L128I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197876
SMART Domains Protein: ENSMUSP00000142779
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 11 33 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197901
AA Change: L173I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912
AA Change: L173I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198111
Predicted Effect possibly damaging
Transcript: ENSMUST00000200486
AA Change: L173I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142584
Gene: ENSMUSG00000041912
AA Change: L173I

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 5.9e-19 SMART
KH 123 195 2.4e-17 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with arrested male meiosis, massive double-strand breaks and impaired piRNA biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Tdrkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02409:Tdrkh APN 3 94430612 unclassified probably benign
IGL02938:Tdrkh APN 3 94429350 unclassified probably benign
IGL03102:Tdrkh APN 3 94424537 missense possibly damaging 0.77
3-1:Tdrkh UTSW 3 94429034 unclassified probably benign
R2352:Tdrkh UTSW 3 94429160 missense possibly damaging 0.77
R3957:Tdrkh UTSW 3 94428249 missense probably damaging 1.00
R4174:Tdrkh UTSW 3 94428233 missense possibly damaging 0.77
R4836:Tdrkh UTSW 3 94425590 missense probably damaging 1.00
R4897:Tdrkh UTSW 3 94429364 missense probably damaging 0.99
R5485:Tdrkh UTSW 3 94428712 missense probably benign 0.01
R7471:Tdrkh UTSW 3 94425956 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAACTGGTTATGAGCCTACTCCTTTC -3'
(R):5'- CTGGTTTCTGCAGAATGGGC -3'

Sequencing Primer
(F):5'- CCTACTCCTTTCTGTAACATGGAAAG -3'
(R):5'- GAATGGGCAATTCTCTTCCGAAG -3'
Posted On2016-07-22